ID: 986757587

View in Genome Browser
Species Human (GRCh38)
Location 5:10852641-10852663
Sequence CAGGGCTCAAATGACTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986757587_986757591 0 Left 986757587 5:10852641-10852663 CCAGGGAAGTCATTTGAGCCCTG No data
Right 986757591 5:10852664-10852686 GATCAAGCTGTACCTGAAACTGG No data
986757587_986757593 12 Left 986757587 5:10852641-10852663 CCAGGGAAGTCATTTGAGCCCTG No data
Right 986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986757587 Original CRISPR CAGGGCTCAAATGACTTCCC TGG (reversed) Intergenic
No off target data available for this crispr