ID: 986757590

View in Genome Browser
Species Human (GRCh38)
Location 5:10852660-10852682
Sequence TTTCAGGTACAGCTTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986757590_986757593 -7 Left 986757590 5:10852660-10852682 CCTGGATCAAGCTGTACCTGAAA No data
Right 986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986757590 Original CRISPR TTTCAGGTACAGCTTGATCC AGG (reversed) Intergenic
No off target data available for this crispr