ID: 986757593

View in Genome Browser
Species Human (GRCh38)
Location 5:10852676-10852698
Sequence CCTGAAACTGGAGCTCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986757589_986757593 -6 Left 986757589 5:10852659-10852681 CCCTGGATCAAGCTGTACCTGAA No data
Right 986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG No data
986757586_986757593 13 Left 986757586 5:10852640-10852662 CCCAGGGAAGTCATTTGAGCCCT No data
Right 986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG No data
986757587_986757593 12 Left 986757587 5:10852641-10852663 CCAGGGAAGTCATTTGAGCCCTG No data
Right 986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG No data
986757590_986757593 -7 Left 986757590 5:10852660-10852682 CCTGGATCAAGCTGTACCTGAAA No data
Right 986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG No data
986757585_986757593 17 Left 986757585 5:10852636-10852658 CCAGCCCAGGGAAGTCATTTGAG No data
Right 986757593 5:10852676-10852698 CCTGAAACTGGAGCTCCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986757593 Original CRISPR CCTGAAACTGGAGCTCCCTC TGG Intergenic
No off target data available for this crispr