ID: 986758022

View in Genome Browser
Species Human (GRCh38)
Location 5:10855854-10855876
Sequence CTGCTCTCCTTGTGCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986758016_986758022 11 Left 986758016 5:10855820-10855842 CCACAGTCAATGACTGGTTGGCA No data
Right 986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG No data
986758015_986758022 12 Left 986758015 5:10855819-10855841 CCCACAGTCAATGACTGGTTGGC No data
Right 986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG No data
986758012_986758022 29 Left 986758012 5:10855802-10855824 CCTAGTGGGGTGGGCAGCCCACA No data
Right 986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG No data
986758011_986758022 30 Left 986758011 5:10855801-10855823 CCCTAGTGGGGTGGGCAGCCCAC No data
Right 986758022 5:10855854-10855876 CTGCTCTCCTTGTGCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986758022 Original CRISPR CTGCTCTCCTTGTGCAAATG GGG Intergenic
No off target data available for this crispr