ID: 986758975

View in Genome Browser
Species Human (GRCh38)
Location 5:10862774-10862796
Sequence CTCAGATCTCATTCTAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986758975_986758977 -8 Left 986758975 5:10862774-10862796 CCCACATTAGAATGAGATCTGAG No data
Right 986758977 5:10862789-10862811 GATCTGAGTGATACCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986758975 Original CRISPR CTCAGATCTCATTCTAATGT GGG (reversed) Intergenic
No off target data available for this crispr