ID: 986764413

View in Genome Browser
Species Human (GRCh38)
Location 5:10911823-10911845
Sequence GATCAGAGTGGGTTAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986764408_986764413 14 Left 986764408 5:10911786-10911808 CCATCAAGAGGAGCAGAAAGATG No data
Right 986764413 5:10911823-10911845 GATCAGAGTGGGTTAAGAAAAGG No data
986764407_986764413 15 Left 986764407 5:10911785-10911807 CCCATCAAGAGGAGCAGAAAGAT No data
Right 986764413 5:10911823-10911845 GATCAGAGTGGGTTAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986764413 Original CRISPR GATCAGAGTGGGTTAAGAAA AGG Intergenic
No off target data available for this crispr