ID: 986765730

View in Genome Browser
Species Human (GRCh38)
Location 5:10924317-10924339
Sequence ATGTGGAGCAGGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986765730_986765737 21 Left 986765730 5:10924317-10924339 CCCTCCTCACTCCTGCTCCACAT No data
Right 986765737 5:10924361-10924383 CCATAGTCCATGCACCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986765730 Original CRISPR ATGTGGAGCAGGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr