ID: 986766587

View in Genome Browser
Species Human (GRCh38)
Location 5:10933501-10933523
Sequence GATGTGGCTGTCATCCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766587_986766597 19 Left 986766587 5:10933501-10933523 CCCCATGGGATGACAGCCACATC No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766587_986766594 7 Left 986766587 5:10933501-10933523 CCCCATGGGATGACAGCCACATC No data
Right 986766594 5:10933531-10933553 CAAGGTCCACATTCAGCTGTAGG No data
986766587_986766596 18 Left 986766587 5:10933501-10933523 CCCCATGGGATGACAGCCACATC No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766587 Original CRISPR GATGTGGCTGTCATCCCATG GGG (reversed) Intergenic
No off target data available for this crispr