ID: 986766591

View in Genome Browser
Species Human (GRCh38)
Location 5:10933517-10933539
Sequence TGGACCTTGTGGGTGAGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766591_986766599 22 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766599 5:10933562-10933584 TGGGCACAGACCAATGCTCTAGG No data
986766591_986766596 2 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data
986766591_986766594 -9 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766594 5:10933531-10933553 CAAGGTCCACATTCAGCTGTAGG No data
986766591_986766597 3 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766591_986766600 26 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766600 5:10933566-10933588 CACAGACCAATGCTCTAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766591 Original CRISPR TGGACCTTGTGGGTGAGATG TGG (reversed) Intergenic
No off target data available for this crispr