ID: 986766592

View in Genome Browser
Species Human (GRCh38)
Location 5:10933527-10933549
Sequence CAGCTGAATGTGGACCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766592_986766597 -7 Left 986766592 5:10933527-10933549 CCCACAAGGTCCACATTCAGCTG No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766592_986766600 16 Left 986766592 5:10933527-10933549 CCCACAAGGTCCACATTCAGCTG No data
Right 986766600 5:10933566-10933588 CACAGACCAATGCTCTAGGTTGG No data
986766592_986766596 -8 Left 986766592 5:10933527-10933549 CCCACAAGGTCCACATTCAGCTG No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data
986766592_986766599 12 Left 986766592 5:10933527-10933549 CCCACAAGGTCCACATTCAGCTG No data
Right 986766599 5:10933562-10933584 TGGGCACAGACCAATGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766592 Original CRISPR CAGCTGAATGTGGACCTTGT GGG (reversed) Intergenic
No off target data available for this crispr