ID: 986766594

View in Genome Browser
Species Human (GRCh38)
Location 5:10933531-10933553
Sequence CAAGGTCCACATTCAGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766587_986766594 7 Left 986766587 5:10933501-10933523 CCCCATGGGATGACAGCCACATC No data
Right 986766594 5:10933531-10933553 CAAGGTCCACATTCAGCTGTAGG No data
986766589_986766594 5 Left 986766589 5:10933503-10933525 CCATGGGATGACAGCCACATCTC No data
Right 986766594 5:10933531-10933553 CAAGGTCCACATTCAGCTGTAGG No data
986766591_986766594 -9 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766594 5:10933531-10933553 CAAGGTCCACATTCAGCTGTAGG No data
986766588_986766594 6 Left 986766588 5:10933502-10933524 CCCATGGGATGACAGCCACATCT No data
Right 986766594 5:10933531-10933553 CAAGGTCCACATTCAGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766594 Original CRISPR CAAGGTCCACATTCAGCTGT AGG Intergenic
No off target data available for this crispr