ID: 986766595

View in Genome Browser
Species Human (GRCh38)
Location 5:10933537-10933559
Sequence AGAACTCCTACAGCTGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766595_986766600 6 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766600 5:10933566-10933588 CACAGACCAATGCTCTAGGTTGG No data
986766595_986766603 24 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766603 5:10933584-10933606 GTTGGCAATGCTGACATTATGGG No data
986766595_986766604 25 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766604 5:10933585-10933607 TTGGCAATGCTGACATTATGGGG No data
986766595_986766602 23 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766602 5:10933583-10933605 GGTTGGCAATGCTGACATTATGG No data
986766595_986766599 2 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766599 5:10933562-10933584 TGGGCACAGACCAATGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766595 Original CRISPR AGAACTCCTACAGCTGAATG TGG (reversed) Intergenic
No off target data available for this crispr