ID: 986766596

View in Genome Browser
Species Human (GRCh38)
Location 5:10933542-10933564
Sequence TTCAGCTGTAGGAGTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766592_986766596 -8 Left 986766592 5:10933527-10933549 CCCACAAGGTCCACATTCAGCTG No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data
986766593_986766596 -9 Left 986766593 5:10933528-10933550 CCACAAGGTCCACATTCAGCTGT No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data
986766588_986766596 17 Left 986766588 5:10933502-10933524 CCCATGGGATGACAGCCACATCT No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data
986766587_986766596 18 Left 986766587 5:10933501-10933523 CCCCATGGGATGACAGCCACATC No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data
986766589_986766596 16 Left 986766589 5:10933503-10933525 CCATGGGATGACAGCCACATCTC No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data
986766591_986766596 2 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766596 5:10933542-10933564 TTCAGCTGTAGGAGTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766596 Original CRISPR TTCAGCTGTAGGAGTTCTCC TGG Intergenic
No off target data available for this crispr