ID: 986766597

View in Genome Browser
Species Human (GRCh38)
Location 5:10933543-10933565
Sequence TCAGCTGTAGGAGTTCTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766593_986766597 -8 Left 986766593 5:10933528-10933550 CCACAAGGTCCACATTCAGCTGT No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766589_986766597 17 Left 986766589 5:10933503-10933525 CCATGGGATGACAGCCACATCTC No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766592_986766597 -7 Left 986766592 5:10933527-10933549 CCCACAAGGTCCACATTCAGCTG No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766587_986766597 19 Left 986766587 5:10933501-10933523 CCCCATGGGATGACAGCCACATC No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766588_986766597 18 Left 986766588 5:10933502-10933524 CCCATGGGATGACAGCCACATCT No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data
986766591_986766597 3 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766597 5:10933543-10933565 TCAGCTGTAGGAGTTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766597 Original CRISPR TCAGCTGTAGGAGTTCTCCT GGG Intergenic
No off target data available for this crispr