ID: 986766599

View in Genome Browser
Species Human (GRCh38)
Location 5:10933562-10933584
Sequence TGGGCACAGACCAATGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766592_986766599 12 Left 986766592 5:10933527-10933549 CCCACAAGGTCCACATTCAGCTG No data
Right 986766599 5:10933562-10933584 TGGGCACAGACCAATGCTCTAGG No data
986766591_986766599 22 Left 986766591 5:10933517-10933539 CCACATCTCACCCACAAGGTCCA No data
Right 986766599 5:10933562-10933584 TGGGCACAGACCAATGCTCTAGG No data
986766593_986766599 11 Left 986766593 5:10933528-10933550 CCACAAGGTCCACATTCAGCTGT No data
Right 986766599 5:10933562-10933584 TGGGCACAGACCAATGCTCTAGG No data
986766595_986766599 2 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766599 5:10933562-10933584 TGGGCACAGACCAATGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766599 Original CRISPR TGGGCACAGACCAATGCTCT AGG Intergenic
No off target data available for this crispr