ID: 986766602

View in Genome Browser
Species Human (GRCh38)
Location 5:10933583-10933605
Sequence GGTTGGCAATGCTGACATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766598_986766602 0 Left 986766598 5:10933560-10933582 CCTGGGCACAGACCAATGCTCTA No data
Right 986766602 5:10933583-10933605 GGTTGGCAATGCTGACATTATGG No data
986766595_986766602 23 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766602 5:10933583-10933605 GGTTGGCAATGCTGACATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766602 Original CRISPR GGTTGGCAATGCTGACATTA TGG Intergenic
No off target data available for this crispr