ID: 986766603

View in Genome Browser
Species Human (GRCh38)
Location 5:10933584-10933606
Sequence GTTGGCAATGCTGACATTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766595_986766603 24 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766603 5:10933584-10933606 GTTGGCAATGCTGACATTATGGG No data
986766598_986766603 1 Left 986766598 5:10933560-10933582 CCTGGGCACAGACCAATGCTCTA No data
Right 986766603 5:10933584-10933606 GTTGGCAATGCTGACATTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766603 Original CRISPR GTTGGCAATGCTGACATTAT GGG Intergenic
No off target data available for this crispr