ID: 986766604

View in Genome Browser
Species Human (GRCh38)
Location 5:10933585-10933607
Sequence TTGGCAATGCTGACATTATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986766601_986766604 -10 Left 986766601 5:10933572-10933594 CCAATGCTCTAGGTTGGCAATGC No data
Right 986766604 5:10933585-10933607 TTGGCAATGCTGACATTATGGGG No data
986766598_986766604 2 Left 986766598 5:10933560-10933582 CCTGGGCACAGACCAATGCTCTA No data
Right 986766604 5:10933585-10933607 TTGGCAATGCTGACATTATGGGG No data
986766595_986766604 25 Left 986766595 5:10933537-10933559 CCACATTCAGCTGTAGGAGTTCT No data
Right 986766604 5:10933585-10933607 TTGGCAATGCTGACATTATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986766604 Original CRISPR TTGGCAATGCTGACATTATG GGG Intergenic
No off target data available for this crispr