ID: 986769161

View in Genome Browser
Species Human (GRCh38)
Location 5:10956175-10956197
Sequence GACTCAGCTGTGTCTCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986769161_986769164 12 Left 986769161 5:10956175-10956197 CCCAGCAGAGACACAGCTGAGTC No data
Right 986769164 5:10956210-10956232 TGTGACATTTGGAAGCATCATGG No data
986769161_986769165 19 Left 986769161 5:10956175-10956197 CCCAGCAGAGACACAGCTGAGTC No data
Right 986769165 5:10956217-10956239 TTTGGAAGCATCATGGCCTCAGG No data
986769161_986769163 1 Left 986769161 5:10956175-10956197 CCCAGCAGAGACACAGCTGAGTC No data
Right 986769163 5:10956199-10956221 GCAACAGTGAGTGTGACATTTGG No data
986769161_986769166 29 Left 986769161 5:10956175-10956197 CCCAGCAGAGACACAGCTGAGTC No data
Right 986769166 5:10956227-10956249 TCATGGCCTCAGGATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986769161 Original CRISPR GACTCAGCTGTGTCTCTGCT GGG (reversed) Intergenic
No off target data available for this crispr