ID: 986769164

View in Genome Browser
Species Human (GRCh38)
Location 5:10956210-10956232
Sequence TGTGACATTTGGAAGCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986769162_986769164 11 Left 986769162 5:10956176-10956198 CCAGCAGAGACACAGCTGAGTCA No data
Right 986769164 5:10956210-10956232 TGTGACATTTGGAAGCATCATGG No data
986769161_986769164 12 Left 986769161 5:10956175-10956197 CCCAGCAGAGACACAGCTGAGTC No data
Right 986769164 5:10956210-10956232 TGTGACATTTGGAAGCATCATGG No data
986769159_986769164 29 Left 986769159 5:10956158-10956180 CCATACTGGCCTGTTTTCCCAGC No data
Right 986769164 5:10956210-10956232 TGTGACATTTGGAAGCATCATGG No data
986769160_986769164 20 Left 986769160 5:10956167-10956189 CCTGTTTTCCCAGCAGAGACACA No data
Right 986769164 5:10956210-10956232 TGTGACATTTGGAAGCATCATGG No data
986769158_986769164 30 Left 986769158 5:10956157-10956179 CCCATACTGGCCTGTTTTCCCAG No data
Right 986769164 5:10956210-10956232 TGTGACATTTGGAAGCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986769164 Original CRISPR TGTGACATTTGGAAGCATCA TGG Intergenic
No off target data available for this crispr