ID: 986769165

View in Genome Browser
Species Human (GRCh38)
Location 5:10956217-10956239
Sequence TTTGGAAGCATCATGGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986769162_986769165 18 Left 986769162 5:10956176-10956198 CCAGCAGAGACACAGCTGAGTCA No data
Right 986769165 5:10956217-10956239 TTTGGAAGCATCATGGCCTCAGG No data
986769161_986769165 19 Left 986769161 5:10956175-10956197 CCCAGCAGAGACACAGCTGAGTC No data
Right 986769165 5:10956217-10956239 TTTGGAAGCATCATGGCCTCAGG No data
986769160_986769165 27 Left 986769160 5:10956167-10956189 CCTGTTTTCCCAGCAGAGACACA No data
Right 986769165 5:10956217-10956239 TTTGGAAGCATCATGGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986769165 Original CRISPR TTTGGAAGCATCATGGCCTC AGG Intergenic
No off target data available for this crispr