ID: 986769166

View in Genome Browser
Species Human (GRCh38)
Location 5:10956227-10956249
Sequence TCATGGCCTCAGGATGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986769162_986769166 28 Left 986769162 5:10956176-10956198 CCAGCAGAGACACAGCTGAGTCA No data
Right 986769166 5:10956227-10956249 TCATGGCCTCAGGATGAGTGTGG No data
986769161_986769166 29 Left 986769161 5:10956175-10956197 CCCAGCAGAGACACAGCTGAGTC No data
Right 986769166 5:10956227-10956249 TCATGGCCTCAGGATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986769166 Original CRISPR TCATGGCCTCAGGATGAGTG TGG Intergenic
No off target data available for this crispr