ID: 986769420

View in Genome Browser
Species Human (GRCh38)
Location 5:10958276-10958298
Sequence CTGCTGTCCCTGGGCTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986769415_986769420 25 Left 986769415 5:10958228-10958250 CCAGCAGAAACGGGGTCCCAGGT No data
Right 986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG No data
986769416_986769420 9 Left 986769416 5:10958244-10958266 CCCAGGTTCATAATCTACACTTG No data
Right 986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG No data
986769417_986769420 8 Left 986769417 5:10958245-10958267 CCAGGTTCATAATCTACACTTGT No data
Right 986769420 5:10958276-10958298 CTGCTGTCCCTGGGCTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986769420 Original CRISPR CTGCTGTCCCTGGGCTGAGC TGG Intergenic
No off target data available for this crispr