ID: 986772324

View in Genome Browser
Species Human (GRCh38)
Location 5:10985541-10985563
Sequence AAAATGCAGCCTATGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986772324_986772333 14 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772333 5:10985578-10985600 CCTTGTGGTTTTCATATCAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165
986772324_986772330 -1 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772330 5:10985563-10985585 TGGGGATGAAGCTTCCCTTGTGG 0: 1
1: 0
2: 3
3: 15
4: 197
986772324_986772334 15 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772334 5:10985579-10985601 CTTGTGGTTTTCATATCAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 212
986772324_986772335 28 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772335 5:10985592-10985614 TATCAGAGGGAATGTTTTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986772324 Original CRISPR AAAATGCAGCCTATGAGGGC TGG (reversed) Intronic