ID: 986772324

View in Genome Browser
Species Human (GRCh38)
Location 5:10985541-10985563
Sequence AAAATGCAGCCTATGAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986772324_986772334 15 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772334 5:10985579-10985601 CTTGTGGTTTTCATATCAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 212
986772324_986772333 14 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772333 5:10985578-10985600 CCTTGTGGTTTTCATATCAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165
986772324_986772335 28 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772335 5:10985592-10985614 TATCAGAGGGAATGTTTTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 210
986772324_986772330 -1 Left 986772324 5:10985541-10985563 CCAGCCCTCATAGGCTGCATTTT 0: 1
1: 0
2: 1
3: 26
4: 193
Right 986772330 5:10985563-10985585 TGGGGATGAAGCTTCCCTTGTGG 0: 1
1: 0
2: 3
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986772324 Original CRISPR AAAATGCAGCCTATGAGGGC TGG (reversed) Intronic
900886920 1:5421748-5421770 AAAGTGCAGCCTTTGAAGACTGG - Intergenic
902636088 1:17735920-17735942 AAGGGGTAGCCTATGAGGGCTGG + Intergenic
903193830 1:21670610-21670632 GAAATGCAGCCCATGTGGCCGGG - Intergenic
911988148 1:104657673-104657695 AAAATGCTCCCTATGTGGGCTGG + Intergenic
916171248 1:162003094-162003116 AAGAGGCAGGCTCTGAGGGCAGG - Intronic
917049492 1:170903675-170903697 AAGATGCAGGAGATGAGGGCTGG - Intergenic
923028089 1:230222904-230222926 AGATTGCAGCCTCTGGGGGCAGG - Intronic
1063548814 10:7008506-7008528 AAAATCAAGCCTATGGAGGCAGG - Intergenic
1064489376 10:15835146-15835168 AAAATGCAAATTAGGAGGGCAGG + Intronic
1064772712 10:18740516-18740538 AACATGTAGCCTTTGGGGGCAGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070604935 10:77892016-77892038 TAAATGCAGATGATGAGGGCAGG - Intronic
1070806734 10:79275165-79275187 GAAAGGCAGCCTATTCGGGCAGG - Intronic
1070988043 10:80705329-80705351 AAAATGCAGAGTATGAGGCCAGG - Intergenic
1073735332 10:106338286-106338308 AAAATGTATACTATGAGGGATGG + Intergenic
1073772447 10:106750272-106750294 AAGCTGCAGCCTATGGGGACAGG + Intronic
1074899545 10:117804358-117804380 AAAATGGAACCTAGGAGGCCTGG - Intergenic
1075957548 10:126536851-126536873 AACATGAAGCTTCTGAGGGCTGG + Intronic
1076101602 10:127784702-127784724 AAAATCCAGCCTATCACTGCTGG - Intergenic
1076177017 10:128375941-128375963 AAAATGCTGCCTAAGAAGGTAGG - Intergenic
1076659167 10:132043992-132044014 AAAATCCATCCAAAGAGGGCAGG + Intergenic
1078441553 11:11372603-11372625 ATGAAGCAGCCAATGAGGGCAGG + Exonic
1078571052 11:12458329-12458351 AAAATGCAGGCCATGCTGGCTGG - Intronic
1079235839 11:18689576-18689598 AAAAAAGAGCCTATGTGGGCCGG + Intergenic
1079293059 11:19205968-19205990 AAAATGAAGACTATGAGGGGCGG - Intronic
1079974965 11:27079413-27079435 ATAATGTAGCCTATGATTGCTGG - Intronic
1080487806 11:32729177-32729199 ACACTGGAGCCTATTAGGGCAGG - Intronic
1080898718 11:36467456-36467478 AAAGAGCAGCCAATGAGGCCAGG - Intergenic
1081713038 11:45230238-45230260 AGAAGGCAGCATATGAGGCCTGG - Intronic
1081719884 11:45280905-45280927 GAAATTCAGGCCATGAGGGCTGG + Intronic
1086961779 11:92985387-92985409 GAATCACAGCCTATGAGGGCCGG + Intergenic
1087360552 11:97153488-97153510 ACAATGCAGCCTAGGAAGTCAGG - Intergenic
1087363577 11:97191521-97191543 AAAATACGGTCTATAAGGGCAGG + Intergenic
1088581895 11:111324745-111324767 AAAATGCATCCCAGGAGGGCTGG + Intergenic
1090411698 11:126513691-126513713 AACATGCAGATTATGGGGGCAGG + Intronic
1090649966 11:128798026-128798048 ACATTGCAACCTATGAGGGTCGG + Intronic
1092537206 12:9401505-9401527 AACATGCAGTCTATGTGAGCAGG - Intergenic
1092557471 12:9571793-9571815 AACATGCAGTCTATGTGAGCAGG + Intergenic
1094513810 12:31116120-31116142 AACATGCAGTCTATGTGAGCAGG - Intergenic
1094802739 12:34055949-34055971 CAAATGCAGTTGATGAGGGCTGG - Intergenic
1095116149 12:38354440-38354462 CAAATGCAGTTGATGAGGGCTGG - Intergenic
1099946490 12:89250622-89250644 AAAATGAAGCAGATGAGGACAGG + Intergenic
1100164851 12:91905265-91905287 AAAAGGCAGTCTCTGAGGGGTGG - Intergenic
1100553707 12:95671867-95671889 GAAATGCAGTGCATGAGGGCAGG - Intronic
1102803785 12:115761378-115761400 AAAAGGCAGGGTATGAGGTCTGG - Intergenic
1102997181 12:117360150-117360172 AGAAGGCAGCCGAGGAGGGCAGG - Intronic
1107408160 13:40134482-40134504 AAAATGGAAACTATCAGGGCAGG + Intergenic
1108321301 13:49293500-49293522 AAGGTGAAGTCTATGAGGGCAGG + Intergenic
1108728445 13:53206533-53206555 AAAATGAAGTTTCTGAGGGCTGG - Intergenic
1110372704 13:74757387-74757409 GAAATGTGGCATATGAGGGCAGG + Intergenic
1110565498 13:76953653-76953675 CAAAAGCAGCATATGTGGGCGGG - Exonic
1111773058 13:92623465-92623487 AAAATGCAGTGTATGAGAGAAGG - Intronic
1113225487 13:108154761-108154783 GAAAAGCAGCATGTGAGGGCAGG - Intergenic
1113248961 13:108429844-108429866 AAACTGCAGATTATGAGGGGAGG - Intergenic
1115861097 14:37687260-37687282 TAAATGCACCCTCTGTGGGCAGG - Intronic
1118853650 14:69604303-69604325 AAAATGGAGACTATGGGGTCTGG + Intergenic
1119446279 14:74666553-74666575 AGAATGTAGCCCATGAGGGCTGG + Intronic
1120009323 14:79395511-79395533 AAAATGCAGGCTGTGAGGCCGGG + Intronic
1120728547 14:87975851-87975873 AAAATGAACCCAATGAGGTCAGG + Intronic
1122949617 14:105034729-105034751 AAAATGCAGCGCCTGAGGGTCGG + Intergenic
1125777704 15:42232773-42232795 AAAATGCAGCTAATGAGGCTGGG - Intronic
1126116606 15:45213511-45213533 AAAATGCATCATAGGAGGGTCGG - Intergenic
1127425093 15:58848356-58848378 AAGATGCAGCCTAGTAGGGAAGG + Intronic
1127482845 15:59393042-59393064 AAAATGGAGCCCAGGAGGCCTGG + Intronic
1127707348 15:61560362-61560384 AAAATCCAGGCTCTGAGGCCAGG + Intergenic
1128562090 15:68675402-68675424 AAAGTAAAGCCTCTGAGGGCAGG + Intronic
1130159760 15:81386716-81386738 GATAGGCAGCCAATGAGGGCTGG - Intergenic
1130982823 15:88824507-88824529 AATATACACCCCATGAGGGCAGG - Intronic
1135137423 16:19895312-19895334 AGGATGGAGCCTGTGAGGGCAGG - Intergenic
1138368480 16:56503622-56503644 AAAATGAAGATTATGAGGCCGGG + Intronic
1139377103 16:66506516-66506538 AGATTGTAGACTATGAGGGCTGG - Intronic
1140282516 16:73567500-73567522 AAAATGCAGTTGAAGAGGGCTGG - Intergenic
1140496846 16:75396838-75396860 TAAATGCAGTCTATTATGGCCGG + Intronic
1142829303 17:2535806-2535828 AAACTGGAGCCCATGAGGGCAGG + Intergenic
1143156107 17:4837386-4837408 AAAATGAAGCCTAAGAAGCCTGG - Intronic
1146100766 17:29979454-29979476 ATAATGCAGCCTATCTGGCCAGG - Intronic
1146566261 17:33915700-33915722 AAAATGCATGCTATGAGGAGTGG - Intronic
1147952234 17:44113694-44113716 AGAGTGCAGCCTTTGAGGGAGGG - Intronic
1149428638 17:56578949-56578971 AAAGAGCATCCTATGAGAGCCGG + Intergenic
1149873677 17:60207403-60207425 AAAATGGAGTCTCTGAGGGTTGG - Intronic
1150087460 17:62284659-62284681 AAAATGGAGTCTCTGAGGGTTGG - Intergenic
1153997127 18:10452995-10453017 AAAACGATGCCTATGAGCGCAGG - Intergenic
1156476155 18:37406721-37406743 TATATGCAGCCTTTGAGTGCAGG + Intronic
1158005912 18:52671829-52671851 AAAGTTCAGCATATGAGGCCGGG - Intronic
1158270015 18:55702601-55702623 AAAATGAAGCCCATAATGGCAGG + Intergenic
1158890001 18:61863919-61863941 AAAAGGCAGCCGATTAGAGCGGG - Intronic
1159140497 18:64388782-64388804 AAAATGCAGAGTTTCAGGGCCGG + Intergenic
1160097924 18:75892121-75892143 AAAATGCATACTGTGTGGGCTGG - Intergenic
1160631647 18:80250638-80250660 AAAAGGCAGGCTATCAGGCCAGG - Intergenic
1161168865 19:2803120-2803142 GAAATGGAGCATCTGAGGGCTGG - Intronic
1161595913 19:5150939-5150961 TAAAGGAAGCCCATGAGGGCTGG - Intronic
1162155705 19:8676962-8676984 ATGATGCAGCCATTGAGGGCAGG + Intergenic
1166737154 19:45092932-45092954 GAACTGCAGACTATGAGGGGCGG - Intronic
925727268 2:6885207-6885229 AAAGTACAACCTATGAGGCCTGG - Intronic
926212410 2:10880552-10880574 AAAATGCAGCCAGTGTGGGTTGG + Intergenic
928416345 2:31095259-31095281 AATTTGTAGACTATGAGGGCTGG - Intronic
928524729 2:32128288-32128310 AAAATGTAAGCTATGAGGCCAGG - Intronic
929042300 2:37757109-37757131 AAAATGCAGCATTTTAGGGAAGG + Intergenic
929521182 2:42652390-42652412 AAAAGACAGCCTTTCAGGGCTGG + Intronic
931513821 2:63029444-63029466 ATTATGCGGCCTTTGAGGGCAGG + Intronic
932594789 2:73087170-73087192 CAGATGCTGCCTATGAGGGCTGG + Intronic
933777031 2:85777320-85777342 CAAAAACAGCCTATGAGGGCAGG + Intronic
935213770 2:100960009-100960031 AAAAAGATGACTATGAGGGCAGG - Intronic
936041732 2:109154985-109155007 AAAATGACTCCTATGAAGGCTGG - Intronic
936587985 2:113775539-113775561 AAAATGTAGCCTAATAGGCCGGG + Intergenic
937563976 2:123261371-123261393 AAAATGGATCCTATGAGGATAGG + Intergenic
939112655 2:138027186-138027208 GAAATGCAGCCCTAGAGGGCAGG + Intergenic
942240751 2:173963512-173963534 AAAATGAAGTCTGAGAGGGCGGG - Intronic
943107414 2:183562959-183562981 AAAATGCAGCATATGAAGACAGG + Intergenic
943430955 2:187800728-187800750 AAGATGGAGCCTATGAGGGACGG + Intergenic
943606847 2:189986340-189986362 CAAATGCAGCCTGTAAGGGATGG + Intronic
946017439 2:216615280-216615302 AAAATACAGGCTATGAGGAGTGG - Intergenic
948091465 2:235299724-235299746 AAAATGCAAGTTATGAGGCCAGG - Intergenic
948800051 2:240429412-240429434 TGATTGCAGCCTGTGAGGGCAGG - Intergenic
1169464203 20:5823194-5823216 AAACAGCAGCCAGTGAGGGCAGG - Intronic
1174598759 20:51707059-51707081 AAGCTGCAGCCTGTGACGGCTGG - Intronic
1174901283 20:54503849-54503871 AAACTGCAGCCTATGAAGATGGG + Intronic
1175076234 20:56376782-56376804 AAAATACAGCCTGGGAGGCCGGG + Intronic
1177227804 21:18280278-18280300 AAACTTCATCCTATGAAGGCCGG + Intronic
1177872277 21:26588428-26588450 AAAATGCAGCGTGTGAGAGAGGG + Intergenic
1178509827 21:33195032-33195054 AAAAGGCAGGCTAAGGGGGCCGG - Intergenic
1178859112 21:36274367-36274389 AAAATGCAGCCAAGGATGACAGG + Intronic
1179364933 21:40750221-40750243 AAAGTGGAGCCAATGAGGTCAGG - Intronic
1179542545 21:42093021-42093043 AAAAGGCAGCCCCCGAGGGCGGG - Intronic
1181769881 22:25117692-25117714 GAAATGCAGCTTCTGAAGGCAGG - Intronic
1181806489 22:25377592-25377614 AACATGCAGCCTTTGATGTCTGG + Intronic
1182060934 22:27396790-27396812 AAAATGCCGCCTCTCAGGGTTGG - Intergenic
1182261963 22:29079568-29079590 CAACTGCAGACTTTGAGGGCTGG + Intronic
1182621301 22:31620150-31620172 AAAAGGCAGCCCCTGGGGGCAGG + Intronic
1182662358 22:31933939-31933961 AAAATGCAGCCTCTAAGAGCTGG - Exonic
1182900085 22:33890731-33890753 GAATTGTTGCCTATGAGGGCTGG - Intronic
1203294495 22_KI270736v1_random:28600-28622 AAAATGCAGCATTTTAGGGAAGG + Intergenic
951052754 3:18113113-18113135 AATATGCAGTCTCTGAGGGCGGG - Intronic
952880737 3:37984773-37984795 AAAATGCAGCCTGAGAGAACTGG + Intergenic
955203336 3:56872801-56872823 AAAAAGCAGTATATGAGGCCAGG - Intronic
955348886 3:58179890-58179912 TACATGCAGCCGATGAGGGCTGG - Intergenic
955785966 3:62539264-62539286 AAATTACAGCCTATAACGGCAGG - Intronic
959100017 3:101999816-101999838 AATATTCAGGCTAGGAGGGCAGG + Intergenic
959518430 3:107297887-107297909 ACAGTGCTGCCTATGAGGGATGG + Intergenic
961209249 3:125112696-125112718 CAAATGCAGCCTATGTTGACTGG + Intronic
961751390 3:129097146-129097168 AAGAAGCAGCCTAGGAGAGCAGG + Intronic
963029648 3:140955983-140956005 AAAATACAGCATTTGAGGGCTGG - Intronic
964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG + Intergenic
964731086 3:159865681-159865703 AACATGCAGCCTCTGGGAGCTGG - Intronic
967342419 3:188414087-188414109 AAAATACATCCCAAGAGGGCAGG - Intronic
970127201 4:12828195-12828217 AAAATGCAGCTGATGTGGCCAGG - Intergenic
970130420 4:12863492-12863514 AGAAGGCAGCCTTTGAGGCCAGG + Intergenic
970890526 4:21038930-21038952 AAAAAGCATCCTGTGAAGGCTGG + Intronic
971148602 4:24006862-24006884 AGAATGCAGTCTATGTGGGTTGG - Intergenic
971408039 4:26340561-26340583 GAAATGCAGCATATTGGGGCCGG + Intronic
974806605 4:66888601-66888623 AAAAGGTAGCCTAAGATGGCAGG - Intergenic
980274673 4:130633767-130633789 AAACTGCAGCCTTTGAGTCCCGG + Intergenic
980975446 4:139606148-139606170 CAAATGCAGCCAGTGAGAGCTGG + Intronic
985171135 4:187151462-187151484 CACATTCTGCCTATGAGGGCTGG + Intergenic
986772324 5:10985541-10985563 AAAATGCAGCCTATGAGGGCTGG - Intronic
990039829 5:51365613-51365635 AAAATACAGCCAAAGTGGGCTGG + Intergenic
993080202 5:83287136-83287158 AAAAGGCAGGGTAAGAGGGCAGG - Intronic
997261868 5:132471568-132471590 ACATTCCAGCCTCTGAGGGCAGG - Intronic
998923167 5:147093440-147093462 AAAATGGAGCCAATGAGATCAGG + Intergenic
999058277 5:148605551-148605573 AAAATGCAATCTGTGAGGCCGGG - Intronic
1000568856 5:162885046-162885068 TAAATGCAGACTATGAGACCTGG + Intergenic
1003708671 6:8564294-8564316 TAAATGCATTCTAAGAGGGCAGG - Intergenic
1003817532 6:9858882-9858904 AATATGCAGCCCTGGAGGGCAGG + Intronic
1004267365 6:14160439-14160461 AAAATGAGGCCTTTGAGGCCTGG + Intergenic
1004538876 6:16529863-16529885 AAAATCCAGGCTATCAGAGCTGG - Intronic
1004981034 6:21024350-21024372 AAAATGCAGCTGAAGAGGCCAGG + Intronic
1006459989 6:34152654-34152676 AAAATGCAGCCCACGAGGGTAGG - Intronic
1007841809 6:44722623-44722645 AGAATGCAGCCCAAGAGGGGAGG - Intergenic
1008145915 6:47891255-47891277 GAAATGCAGCCTCTGAGGGCTGG + Intronic
1008629628 6:53350817-53350839 AAAACGCAGCCTTTGGGGGATGG - Intergenic
1008860814 6:56147973-56147995 AGAAGACAGCCTATGAGGGAGGG - Intronic
1015388764 6:132656125-132656147 AAACTGCAGCCTCTGGAGGCTGG - Intergenic
1017558929 6:155606187-155606209 AAAATGCAGCCACTGAGGACTGG - Intergenic
1021288650 7:18815911-18815933 AATCTGCAGCCTTTGAGGGAGGG - Intronic
1022305066 7:29139359-29139381 AAAATGCAGCCAAGGAGATCAGG + Intronic
1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG + Intronic
1024993073 7:55251483-55251505 AGAATGCAGTCCATGTGGGCTGG - Intronic
1026572226 7:71541254-71541276 AAAATGCTGCGTATGATGGGTGG + Intronic
1027058055 7:75064033-75064055 AAAATTCATCCTAAGAGGGCAGG + Intronic
1027227881 7:76255971-76255993 AAAATGCTGTCTATGAGGCCTGG - Intronic
1027265261 7:76491576-76491598 AAAATGCAGGCTCTCAGGCCAGG - Intronic
1027316630 7:76989695-76989717 AAAATGCAGGCTCTCAGGCCAGG - Intergenic
1027722913 7:81768054-81768076 AGAATGCAGCCCAAGAGTGCTGG - Intronic
1029369682 7:100140998-100141020 AAAAATGAGCCTGTGAGGGCTGG - Intergenic
1029548618 7:101224363-101224385 AAGAAGCAGCCAAGGAGGGCAGG - Intergenic
1031101665 7:117487912-117487934 AAAATGAAGCCTATGTTGGCTGG + Intronic
1031819828 7:126486216-126486238 AATGTGCAGCCTCTGAGAGCAGG - Intronic
1031961514 7:127994284-127994306 GAAATGCAACGTAAGAGGGCAGG - Intronic
1032084843 7:128878572-128878594 CAAACGCAGCCTCCGAGGGCAGG + Exonic
1033209712 7:139451883-139451905 AAAATACATCCTATGTGGGCAGG - Intergenic
1035343728 7:158183683-158183705 AGAATTCAGCCCATGGGGGCGGG - Intronic
1036420130 8:8587874-8587896 AAAAGGCATCGTATGAAGGCAGG + Intergenic
1036504439 8:9342539-9342561 ATAAGTCAGCCTAAGAGGGCTGG + Intergenic
1037978487 8:23232156-23232178 AAATTTTAGCCTATGACGGCCGG + Intergenic
1042123247 8:65510910-65510932 AAAATGCAGCACATCAGTGCTGG + Intergenic
1047404218 8:124571668-124571690 AAATAACAGCCTATGAGGCCGGG + Intronic
1053066037 9:35070117-35070139 AAAATGCAGCCTATGTGTGAGGG - Intronic
1056241741 9:84654672-84654694 ATAATTCAGCTTCTGAGGGCAGG - Intergenic
1057858056 9:98617404-98617426 CAAATGCAGCCTGGGAGAGCAGG + Intronic
1060277121 9:122190875-122190897 CAAATGCAGCCTACGTGAGCTGG - Intronic
1060853996 9:126900350-126900372 AAAATTCAGCATATGAGGCCAGG + Intergenic
1061271673 9:129547235-129547257 AGAGTGCAGCCCATGGGGGCAGG - Intergenic
1185971041 X:4664227-4664249 CAAAGTCATCCTATGAGGGCAGG + Intergenic
1187739156 X:22336527-22336549 AAAATGCAGCCTTTTGGGTCCGG + Intergenic
1188094157 X:26002095-26002117 GAAAAGCAGCCTGTGAGTGCAGG + Intergenic
1188342966 X:29028246-29028268 AAAATGGTGCCTACCAGGGCTGG - Intronic
1189532285 X:41898188-41898210 AAAATACAGCCTATCAAGACTGG - Intronic
1190032636 X:46989132-46989154 AAAAAGCAGCCAATGGCGGCAGG - Intronic
1190357453 X:49618955-49618977 GAAGTGCAGCCCATGAGGCCGGG + Intergenic
1190482271 X:50889488-50889510 AGAATGTAGTCTATGGGGGCTGG - Intergenic
1194120941 X:89962859-89962881 CAAAGTCATCCTATGAGGGCTGG - Intergenic
1195760934 X:108245678-108245700 AATATGCACCCTTTGAGGACAGG - Intronic
1197098723 X:122626111-122626133 ATAATGCAGCTAATGGGGGCAGG - Intergenic
1197870300 X:131057940-131057962 AAATTCCAGCCTTTGGGGGCAGG + Intergenic
1198863110 X:141091880-141091902 AAAAAGTACCCTATGAGGGCCGG + Intergenic
1198899580 X:141495507-141495529 AAAAAGTACCCTATGAGGGCCGG - Intergenic
1202057396 Y:20849207-20849229 AAACTGGAGCCTTTGAGGGGTGG - Intergenic
1202163945 Y:21967182-21967204 AACTTGCAGCCTATAAGGGAAGG - Intergenic
1202227411 Y:22619182-22619204 AACTTGCAGCCTATAAGGGAAGG + Intergenic
1202315714 Y:23576472-23576494 AACTTGCAGCCTATAAGGGAAGG - Intergenic
1202555054 Y:26093602-26093624 AACTTGCAGCCTATAAGGGAAGG + Intergenic