ID: 986772746

View in Genome Browser
Species Human (GRCh38)
Location 5:10988509-10988531
Sequence CCTCAGAGAGAGATCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986772740_986772746 -3 Left 986772740 5:10988489-10988511 CCACATCCTGGGGCCATCTTCCT 0: 1
1: 0
2: 2
3: 24
4: 275
Right 986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG 0: 1
1: 0
2: 0
3: 24
4: 284
986772741_986772746 -9 Left 986772741 5:10988495-10988517 CCTGGGGCCATCTTCCTCAGAGA 0: 1
1: 0
2: 0
3: 21
4: 207
Right 986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG 0: 1
1: 0
2: 0
3: 24
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986772746 Original CRISPR CCTCAGAGAGAGATCATGGA GGG Intronic
900764833 1:4497827-4497849 CCACAGAGAGAGGCCATGGAAGG - Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901938173 1:12642288-12642310 CTTAACAGAGAGATCAGGGAAGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904813128 1:33176689-33176711 CCTCAGAGGTAGCTCAGGGACGG + Intronic
904949042 1:34221226-34221248 CATCAGAGAGATCTCATGAAAGG + Intergenic
905376034 1:37520866-37520888 CAACAGAGAGAGATCCTGGGAGG + Intergenic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907986914 1:59541254-59541276 CCCCATAGAAAGATGATGGAAGG + Intronic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910855987 1:91696427-91696449 CCTTATAGAAAGATCATGGTTGG - Intronic
911409361 1:97483329-97483351 CCTGAGAAAGGGCTCATGGAAGG + Intronic
911583955 1:99668539-99668561 CCTGAGAGAAATATGATGGAAGG - Intronic
912042832 1:105412927-105412949 CATGGGAGAGAAATCATGGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913212552 1:116593645-116593667 CCTGAGAAAGAGATCATTGAGGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
914999727 1:152578390-152578412 CTTCAGAGAGAGAAGGTGGAGGG - Intronic
916268323 1:162914832-162914854 CATCAGAGAGATATTATGAAAGG - Intergenic
917858532 1:179122543-179122565 ATCCAGAGAGAGATCTTGGAAGG - Intronic
917966727 1:180183498-180183520 CCTCAGGGCGAGCTTATGGATGG + Intronic
920528667 1:206685882-206685904 CCGCAGAGAGAGAAAAAGGAGGG - Intronic
920815074 1:209323653-209323675 CTGCAGAAAGAGATCATGAAAGG - Intergenic
921382828 1:214542608-214542630 ACCCAGAGAGAGATTAGGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922654058 1:227365411-227365433 CCTGAGAGTGAGTTTATGGAGGG + Intergenic
923148884 1:231216784-231216806 TCTCAGAGACAGCTCATGGCAGG + Exonic
923459695 1:234197565-234197587 CATCAGGGAGTGATCATGGAGGG - Intronic
923622206 1:235588273-235588295 CCTGAGAGGGAGGCCATGGAGGG - Intronic
924788869 1:247225294-247225316 CCTCAGAGAGAATTCTTGAAAGG + Intergenic
1062999851 10:1906180-1906202 GCTGAGAGATTGATCATGGAAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063896301 10:10685985-10686007 CCTCAGTGAAAGATCAAGGAGGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064234867 10:13564536-13564558 CATCAGGGAAGGATCATGGAGGG + Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1072308566 10:94132250-94132272 CCTCCGAGACAGCCCATGGAAGG + Exonic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073079484 10:100849770-100849792 CCTCAGAGACAAACCATAGAAGG + Intergenic
1075663523 10:124214818-124214840 CTGCAGAGAGAGACCATGGGTGG + Intergenic
1076466355 10:130684821-130684843 ACTGAGAGAGAGATGATAGAAGG - Intergenic
1076509216 10:131000127-131000149 CCTCAAAGAGAGACAATGGAAGG - Intergenic
1077260925 11:1619896-1619918 ACTTAGAGAGGGCTCATGGAAGG + Intergenic
1077557146 11:3231222-3231244 CCCCAGGGAGAGAGCATGGCAGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078875629 11:15392714-15392736 CATCACAGAGATATCTTGGATGG - Intergenic
1080660541 11:34292728-34292750 CCTCATAGGGAGGTCAGGGAGGG + Intronic
1080872797 11:36251793-36251815 CAACAGAGAGATATCAGGGAGGG - Intergenic
1080985273 11:37455751-37455773 CCTCAGAGAGAGGCCATGTGTGG + Intergenic
1081713846 11:45234618-45234640 CCTCAGAGAGAGAGCACGCCAGG + Intronic
1084483104 11:69433356-69433378 CTTCAGAGAGAGGACATGAATGG - Intergenic
1084745235 11:71165903-71165925 CCTGACAGAGTGCTCATGGAGGG - Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1084793221 11:71488290-71488312 CCGCCGAGAGAGCTCAAGGAGGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085655379 11:78309833-78309855 CAACAGAGAGAGATCAAGGGTGG + Intronic
1085714560 11:78861004-78861026 CGTCTGATAGAGATCATAGAGGG + Intronic
1086820714 11:91433240-91433262 CCTGAGACAGAGACCATGGTGGG - Intergenic
1086925798 11:92639514-92639536 CCTCAGAGAGAGATGGGGCATGG - Intronic
1087240023 11:95764111-95764133 CCTCACAGATAGATGAAGGAGGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091128511 11:133123728-133123750 CCACAGAGAGAGACCCAGGAAGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093966358 12:25331311-25331333 ACTGAGAGAGAGAGCATTGAGGG + Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1095238250 12:39824862-39824884 CTTCAGGCAGAGATCAAGGAGGG + Intronic
1095698852 12:45170563-45170585 CTTCAGAGAGAAAGAATGGAAGG + Intergenic
1096770428 12:53932909-53932931 CCTAAAAGGGAGATAATGGAAGG - Intergenic
1098302520 12:69068823-69068845 CCTGGGAGAGAGATGGTGGAGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098411954 12:70195739-70195761 CAGCAGAGCCAGATCATGGAAGG - Intergenic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100204507 12:92333536-92333558 TCTTAAAGAGAGAGCATGGAGGG - Intergenic
1102430392 12:112878627-112878649 CTTTAGAGAGTGATCAAGGAGGG + Intronic
1102438622 12:112944740-112944762 TCCCAGAGAGAGAACATGAATGG - Intronic
1103275935 12:119712060-119712082 CCTCAGAGAGAGAGCCTGAGGGG + Intronic
1103458334 12:121084883-121084905 CCCCAGAGAGGCAACATGGAGGG + Intergenic
1103989122 12:124786487-124786509 CCTCAGAGCGGGGCCATGGAGGG - Exonic
1104332256 12:127857948-127857970 CCTCCGAGACAGATCAAGAATGG + Intergenic
1104526564 12:129529443-129529465 ACACAGAGAGAGAGCATGGGGGG - Intronic
1104575761 12:129964638-129964660 CAGCAGAGAGACATCATGCATGG + Intergenic
1105215796 13:18284268-18284290 GCTGAGAAAGAGATCATTGAGGG - Intergenic
1105271191 13:18876026-18876048 CCGCAGTGAGATATCATGCATGG - Intergenic
1105599518 13:21874113-21874135 CCTGAGAGACAGTTTATGGAAGG + Intergenic
1106454063 13:29911517-29911539 CCTCAAAGAGAGCTCCTTGAAGG - Intergenic
1107295322 13:38901330-38901352 CCTCAGAGAGACATTATGCCTGG + Intergenic
1107539229 13:41370607-41370629 CTTCAGAGACAAAGCATGGATGG - Intronic
1108835269 13:54537964-54537986 CCTTAGAGAGATCTCATAGATGG - Intergenic
1109061118 13:57621596-57621618 TCACAGAGAGAGATCCTTGAGGG + Intergenic
1110126096 13:71943769-71943791 CCTGAGAGAGAGATCCAGGCAGG - Intergenic
1111185010 13:84722269-84722291 CTTCAAAAAAAGATCATGGAAGG + Intergenic
1112806147 13:103165780-103165802 CCCCAGGGAGAGATCAGAGAGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114396078 14:22362967-22362989 CCTCAGATAGAGGTCATGGCTGG + Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114699237 14:24660444-24660466 CCTCATAAAGAGTTCATGGTGGG + Intergenic
1115453535 14:33575880-33575902 CCTGAGAAAGAGAAAATGGAAGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1118851429 14:69586867-69586889 CATCACAGAGAGTTCGTGGATGG + Intergenic
1119155033 14:72402186-72402208 GCCCTGAGAGAGATCTTGGACGG - Intronic
1121114835 14:91336415-91336437 CCCCAGAGTGGGGTCATGGATGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126371124 15:47948068-47948090 CCTGTGATAGAGATCATGAAGGG - Intergenic
1126536869 15:49775837-49775859 CCTGAGAGAGAAAACAGGGAGGG + Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1130020459 15:80226448-80226470 GGCCAGAGAGAGATCAGGGAGGG - Intergenic
1132023229 15:98382745-98382767 CCTCAGCCACACATCATGGAAGG + Intergenic
1133971519 16:10571524-10571546 CCTCTGAGTCAGATCATGTAAGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1136608548 16:31352674-31352696 CTACAGAGAGAGAAGATGGAGGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138391740 16:56675539-56675561 CCTCAGAGGAGGAGCATGGAGGG + Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140277716 16:73525719-73525741 CCTCCTAGAGAGACCAAGGAAGG + Intergenic
1141309908 16:82903523-82903545 CGTCAGAGAAAGATAATGGCAGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143555576 17:7657655-7657677 CTGCAGAGAGAGACCATGGTAGG - Exonic
1143687428 17:8529231-8529253 GCTGAGAGAGAGCTGATGGATGG - Intronic
1145393498 17:22475673-22475695 CCTCAAAGAGAGCTCAAAGAAGG + Intergenic
1145882234 17:28360727-28360749 CCCCAAAGTGAGATCATTGAAGG + Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1148406104 17:47417830-47417852 CCTGACAGAGAGAACATGAAAGG - Intronic
1149290957 17:55216951-55216973 CCTCAGAGAGCATTCATGAAAGG - Intergenic
1152007092 17:77689152-77689174 CCTCAGAGAGTGCCCATGAATGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152566673 17:81103406-81103428 CCCCAGAGAGTGCTCAGGGAGGG + Intronic
1153299205 18:3578246-3578268 CCTAAGAGAGAAAGCATGGAAGG + Intronic
1158143513 18:54283510-54283532 CTTGAGAGAGAGAGAATGGAAGG - Intronic
1160277457 18:77451092-77451114 CCTCAGAGACAGATGAGGCATGG - Intergenic
1161154737 19:2726776-2726798 CCACAGGGAGAGACCCTGGAGGG + Intronic
1161606439 19:5217439-5217461 CCTCATAAAGGGATCATGCAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167399524 19:49255632-49255654 CCACAGAGGGAGATCGGGGATGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168275350 19:55274845-55274867 CCACAGAGGGACAACATGGAGGG + Intronic
925130835 2:1493019-1493041 CCACAGAGTCAGACCATGGACGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
927316563 2:21689866-21689888 CCTCAGATAGAAGTCATGGTGGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
928884981 2:36138072-36138094 TCTCAGAGGGAGTTCATGCATGG - Intergenic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
931930142 2:67122700-67122722 CATCAGAGAGATACCATGGCAGG + Intergenic
934298535 2:91762457-91762479 CCTGAGAAAGAGATCATTGAGGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937078035 2:119121284-119121306 TCTGAGAGAGAGAGAATGGAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939023094 2:136981524-136981546 CCTCAGAGAAAGAGCACAGAGGG - Intronic
939726152 2:145723766-145723788 CCTCAGAGAGACATAATGATGGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
941597665 2:167497797-167497819 CCTTAGAGAGAGGCCATTGATGG + Intergenic
942554744 2:177160191-177160213 CATCAAAGGGAGATCATGGTGGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
943751590 2:191514956-191514978 CCTCAGGGAGAGTTCAGAGATGG + Intergenic
945178102 2:207064027-207064049 CCTTAGAGAGAGATGGGGGACGG + Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945436028 2:209818263-209818285 CTTCAGAGAGATCTCATAGAGGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
949063719 2:241976410-241976432 CAGCAGAGAGAGGACATGGATGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170532559 20:17309121-17309143 GACCAGAGACAGATCATGGAGGG + Intronic
1171984500 20:31650256-31650278 CCACACAGAGTGACCATGGAGGG - Intergenic
1173015626 20:39222915-39222937 CCTCAGAGAGAAACCAGGAAAGG - Intergenic
1173127749 20:40355575-40355597 CCTCAGACAAAGATAATGAAAGG + Intergenic
1174282089 20:49446870-49446892 CTTCAGAGGGAGATGAGGGATGG - Intronic
1174770198 20:53292376-53292398 CTTCAGAAAGAGTTCTTGGAAGG - Intronic
1175431342 20:58906397-58906419 CCTCTGGGAGAGACCATGGTGGG - Intronic
1178109693 21:29357739-29357761 CATCACAGAGAGAGCAAGGATGG - Intronic
1179430178 21:41316402-41316424 CCTCAGACAGTGGACATGGACGG + Intronic
1181005512 22:20011552-20011574 CCTCAGGGTGGGATCATGGGGGG + Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181849938 22:25742855-25742877 CCTCAGACAGAGCTCAAGGAAGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
949130623 3:496037-496059 CCACAGAGTCAGATCATGGATGG - Intergenic
951055765 3:18144922-18144944 CCTTAGAGAGAGTTCAGAGAAGG - Intronic
952548555 3:34449950-34449972 CCTGAGACAGAGCTCCTGGAGGG - Intergenic
953194147 3:40716060-40716082 GCTCACTGAGATATCATGGAGGG + Intergenic
953353348 3:42232734-42232756 CCTCAGAGAGAGATGTTGGTTGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954424152 3:50434556-50434578 CCTCTGAGAGAGGGCATGGAAGG + Intronic
954929286 3:54266885-54266907 CCTCTTAGGGAGAGCATGGAGGG + Intronic
956682937 3:71798268-71798290 CCACAAAGAAATATCATGGATGG + Intergenic
956817733 3:72923761-72923783 GGTCTGAGAGAGATCATAGAAGG + Intronic
957389021 3:79537565-79537587 CCTCAGAGAGAAGCCATGGGTGG + Intronic
957964993 3:87310736-87310758 ACTCAGAGAGAGGTAATGCAGGG - Intergenic
958626481 3:96631585-96631607 CCTGAGAGAGGGATCTGGGATGG - Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
959467935 3:106712996-106713018 CCTCTGAGAGGGATCAATGAGGG + Intergenic
960157353 3:114309352-114309374 CCTCTGAGAGAGATGGTGGAAGG - Exonic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
961651080 3:128416957-128416979 ACTCAGAGAGCGATCGTGGTGGG + Intergenic
962678865 3:137778214-137778236 CCTCTGAGAAAGATGATAGAAGG - Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967032205 3:185618426-185618448 CCTCAAAGAGAGAACATGCAGGG - Intronic
967707077 3:192663546-192663568 CCCCAGAGAGATGACATGGAAGG - Intronic
967893999 3:194382542-194382564 ATTCAGGGAGAGATCCTGGAAGG - Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969466798 4:7362094-7362116 CCAGAGAGACAGAGCATGGAAGG + Intronic
969594955 4:8143597-8143619 CCTGAGAGAGAAATCCTGGCAGG - Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971096386 4:23409316-23409338 CCTCAGACAGTGGCCATGGATGG + Intergenic
972277558 4:37571309-37571331 CCATGGAGAGAGATCTTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
975478729 4:74854070-74854092 TCTCAGAGAGAGGTCAAGGAAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975980470 4:80152808-80152830 CTTCAGACAGAGAACATGGCTGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980977276 4:139623387-139623409 CCTCAGAGAGAGAATACGAAGGG + Intergenic
981348017 4:143698718-143698740 CTACAGAGAGACATAATGGAAGG - Exonic
981391675 4:144197818-144197840 CAGAAGAGAGAGAACATGGAGGG - Intergenic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
984918885 4:184746873-184746895 CCTGAGAAAGAGAAAATGGAAGG + Intergenic
985137189 4:186798210-186798232 CCTGAGAGCAAGATTATGGATGG + Intergenic
986058413 5:4162494-4162516 CCTCAGACAGAGAACTTTGAGGG - Intergenic
986772746 5:10988509-10988531 CCTCAGAGAGAGATCATGGAGGG + Intronic
986841069 5:11698219-11698241 CATCAGATAGATTTCATGGAGGG - Intronic
987366873 5:17156656-17156678 CATCAGAGTGAGATCAGGGAGGG - Intronic
989342182 5:40388330-40388352 TGTGAGAGAGAGATCATGTAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992414950 5:76543480-76543502 CCTCAGAGAAACATGCTGGAGGG - Intronic
992738270 5:79745763-79745785 CCTCAGAGGGAAAGCATGGCAGG - Intronic
997024618 5:130044028-130044050 GCTCAGAGAGAGATCAGAGTTGG + Intronic
997207312 5:132057313-132057335 CCTCGCAGAGAGCTCAGGGAAGG - Intergenic
998503134 5:142651068-142651090 GCTCAGAGAGAGGTGAAGGAAGG + Intronic
999596407 5:153210106-153210128 CCTCAGAGAGGGGTCCTGGAAGG - Intergenic
999824590 5:155262012-155262034 CCTCTGAGAGAGATCACAAAGGG + Intergenic
1003700779 6:8462580-8462602 CCTCAGGGAGAGGCCATGGTTGG + Intergenic
1007354699 6:41305556-41305578 CCTCAGGGAGAGATTAGGGAGGG + Intergenic
1007654454 6:43443925-43443947 TCTCAGAGGGAGGTCCTGGAGGG - Exonic
1008173924 6:48242914-48242936 CCCCAGAGAGAGTTAATTGATGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1011447638 6:87459346-87459368 TCTGACAGAGAGGTCATGGAGGG - Intronic
1012037928 6:94166358-94166380 CCTCAGGCAGGGATCATGGTTGG - Intergenic
1014654283 6:124079968-124079990 CCTCAGAGAGAAATGGTGGGTGG + Intronic
1017492262 6:154955077-154955099 CCGCATGGAGAGATCAAGGATGG + Intronic
1017893371 6:158657780-158657802 TTTCAGAAAGACATCATGGAGGG - Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020431335 7:8119192-8119214 CCTCTGACAGAGTTCCTGGAGGG + Intronic
1021680518 7:23126699-23126721 ACAGAGAGAGAGATCTTGGAAGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1023404623 7:39819773-39819795 CCTCAGAGAGGACTGATGGAAGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1032023884 7:128426144-128426166 CCTCAAAGAGAGATCCAGAAAGG - Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035264069 7:157680082-157680104 CCTCGGAGAGAGAGAATGGTAGG - Intronic
1037950987 8:23018730-23018752 CCTCAGAGAGTGCTTATGGTGGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038676737 8:29629708-29629730 CCTTGGAGAGGGATGATGGAAGG + Intergenic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039596825 8:38797873-38797895 CCACAGACAGAAATCATAGAAGG - Intronic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041419388 8:57649196-57649218 CAGCAGAGAGGGATAATGGATGG + Intergenic
1044323683 8:90835409-90835431 CCTCATAGACAGATAGTGGAGGG - Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045134001 8:99192474-99192496 CCTCATAGAGTTATTATGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048208917 8:132438599-132438621 TCTCTGAGAGTGATGATGGATGG + Intronic
1048438689 8:134443054-134443076 CTTCAGAGACAGAGCATTGATGG - Intergenic
1049630239 8:143650209-143650231 CTTCAGAGAGAGCTCATAGAGGG + Exonic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1051412878 9:16809251-16809273 CATCAGAGAGTGATCCAGGAGGG - Intronic
1053034478 9:34812581-34812603 CCTCAGAGACAGAACCTGAATGG - Intergenic
1058772798 9:108254018-108254040 CTTCAAAGAGAGATGATGGGAGG - Intergenic
1059557640 9:115297346-115297368 CCTCTGAGAAAGCACATGGATGG + Intronic
1060368068 9:123040074-123040096 CCTCAGAGAGGGATCAAAGAAGG + Intronic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1060593112 9:124831809-124831831 CCTCAGCGTGAGAAAATGGAAGG + Intergenic
1061748214 9:132755487-132755509 CCTGGGAGAGGGACCATGGAGGG + Intronic
1185690963 X:2154949-2154971 CCTCAGAGAGGGAGGATGTAAGG + Intergenic
1187169221 X:16835016-16835038 CCACAGAGAGAGATCACAGCAGG - Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1189868998 X:45362403-45362425 TCTCAGAGAGAGCTGATGTATGG + Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1190982589 X:55469418-55469440 TCCCAGAGAAAGAACATGGATGG + Intergenic
1190986110 X:55503765-55503787 TCCCAGAGAAAGAACATGGATGG - Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1193344497 X:80388964-80388986 ACTCAGCCAGTGATCATGGAGGG - Intronic
1194975468 X:100392055-100392077 CCTCAAGAGGAGATCATGGAAGG - Intronic
1197093453 X:122566501-122566523 CTCAAGAGAGAGGTCATGGATGG - Intergenic
1197777293 X:130126867-130126889 GTTCAGAGAGAAATCATGCATGG + Intergenic
1199558335 X:149134002-149134024 CAAAAGAGAGAGATGATGGAGGG + Intergenic
1200497497 Y:3902794-3902816 CCTTAGACAGAGTTCATGGTGGG + Intergenic
1201636024 Y:16124311-16124333 CCTGAGCGAGAGAACATTGAGGG + Intergenic