ID: 986774153

View in Genome Browser
Species Human (GRCh38)
Location 5:10998325-10998347
Sequence CACTTTGAATGGAGGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986774148_986774153 -9 Left 986774148 5:10998311-10998333 CCTGTGGGTATAGGCACTTTGAA 0: 1
1: 0
2: 0
3: 5
4: 68
Right 986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG No data
986774143_986774153 18 Left 986774143 5:10998284-10998306 CCTCTGAGGATGGCCAGGGACTG 0: 1
1: 0
2: 2
3: 24
4: 323
Right 986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG No data
986774142_986774153 19 Left 986774142 5:10998283-10998305 CCCTCTGAGGATGGCCAGGGACT 0: 1
1: 0
2: 1
3: 20
4: 192
Right 986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG No data
986774138_986774153 30 Left 986774138 5:10998272-10998294 CCTGACTCAGACCCTCTGAGGAT 0: 1
1: 0
2: 0
3: 23
4: 187
Right 986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG No data
986774146_986774153 5 Left 986774146 5:10998297-10998319 CCAGGGACTGCATGCCTGTGGGT 0: 1
1: 0
2: 2
3: 20
4: 258
Right 986774153 5:10998325-10998347 CACTTTGAATGGAGGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986774153 Original CRISPR CACTTTGAATGGAGGGGAGA AGG Intronic
No off target data available for this crispr