ID: 986778634

View in Genome Browser
Species Human (GRCh38)
Location 5:11044144-11044166
Sequence AGGGAAAGGACCTCCTGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986778634 Original CRISPR AGGGAAAGGACCTCCTGTCA CGG (reversed) Intronic
904171601 1:28595192-28595214 TGGGAAAGGCCCTCCCTTCAGGG + Exonic
906464813 1:46068539-46068561 AGGGAAAGGAGTTCTTGTGATGG + Intronic
907017631 1:51032725-51032747 ATGGGAAGGAACTCCTGTCGTGG - Intergenic
911133318 1:94413625-94413647 AAGGAAAGGACATCCTGACAAGG - Intergenic
911345538 1:96692503-96692525 AGGGAAAGAATTTACTGTCAAGG + Intergenic
917123404 1:171664412-171664434 ATGGAAAGGCCCTCCTGATAAGG + Intergenic
919416768 1:197320290-197320312 AGGAAAAGCTCCACCTGTCAGGG - Intronic
919431493 1:197497672-197497694 AGGGGAAAGACCTCCTAACATGG + Intergenic
919683941 1:200463735-200463757 AGGGATACGACGTCCTGACAAGG + Intergenic
923289640 1:232531880-232531902 AGGGGAAGGAGCTCCAATCAGGG + Intronic
1062920875 10:1278701-1278723 AGGGAGAGGACCTCCAAACAGGG - Intronic
1068002908 10:51357350-51357372 AGGGAAAGCAGCTTCTGTCTTGG + Intronic
1070175175 10:73963819-73963841 AGGGACAGGTTCTTCTGTCAGGG - Intergenic
1070821319 10:79356494-79356516 AGGGAACGGCCCTGCTTTCAGGG - Intergenic
1071002988 10:80852213-80852235 AGGTATAGGAACTCCTGTCCAGG - Intergenic
1073439361 10:103543632-103543654 ATGGGAAGGGCCTCCTGCCATGG + Intronic
1075304802 10:121358403-121358425 AGGCAAAGCTCCTCCTGTTATGG + Intergenic
1075635346 10:124026869-124026891 AGGGGAAATACCTCCAGTCAGGG + Intronic
1075973342 10:126673451-126673473 TGGGAAAGGCCTTCCTGTCTGGG + Intergenic
1079003143 11:16774225-16774247 GGCGAAAGGAACTGCTGTCATGG + Intergenic
1080646735 11:34193172-34193194 AGTGAAAGAGCCTCTTGTCAGGG - Intronic
1084115388 11:67040106-67040128 AGGGCAAGGACCTCCTGGAGCGG + Exonic
1084212949 11:67632235-67632257 AGGGACAGGACCTCCAGGAAGGG - Intronic
1088854624 11:113736536-113736558 AGGGAAAAGCCCTGCTATCAAGG + Intronic
1089548489 11:119250314-119250336 AGGGAAAGAACCACCTGAAAGGG - Intronic
1090501610 11:127266496-127266518 ATGGAAAGGACCACGTGGCAGGG + Intergenic
1092029978 12:5275925-5275947 TGGGAAAGGAGCTCTTGGCAGGG - Intergenic
1096255233 12:50058330-50058352 GGGGTAAGGAGCTCCTGTCCTGG - Intronic
1097174599 12:57135585-57135607 CGTGAAAGAACTTCCTGTCAGGG - Intronic
1100172760 12:91994496-91994518 ATATAAAGGACCTGCTGTCAGGG + Intronic
1100783122 12:98050247-98050269 AGAGAAAGAACCTTCTCTCATGG - Intergenic
1101498946 12:105283219-105283241 AGGGAAAAAACCTCATGACATGG + Intronic
1106911754 13:34470580-34470602 ATGGAAAGAACCTCCTATCTGGG - Intergenic
1107300213 13:38958199-38958221 AGGGAGAGGACCTCCCATAATGG + Intergenic
1107464972 13:40641143-40641165 AGGAAAAGAACCTCCTTTTACGG - Intronic
1107468306 13:40667850-40667872 AGGTCCAGGACATCCTGTCAAGG + Intergenic
1107553336 13:41496738-41496760 AGGGCAAAGACATCCTGTCCTGG + Intergenic
1107987458 13:45787565-45787587 AGGCAAAGGACCTGCTGACAGGG + Intronic
1108257802 13:48627650-48627672 AGGCAAAGGCCCTACTGTCAGGG + Intergenic
1109720555 13:66270160-66270182 AGGGAAAGCAGTCCCTGTCAGGG + Intergenic
1111866452 13:93774765-93774787 AGGGAAAGTATCTTCTGTAAGGG + Intronic
1112165605 13:96916750-96916772 AGGGACAGGATCTCCTGCCAGGG + Intergenic
1113335798 13:109374539-109374561 GGGGAAATGAGCTCCTGTCCTGG + Intergenic
1114529934 14:23389270-23389292 AGGGAAAGACCCTCCAGTCTAGG - Intronic
1115504191 14:34078677-34078699 AGGGAAAGGCCCTTCTTACATGG - Intronic
1120824528 14:88943473-88943495 AAAGAAAGCACCTCCTCTCAAGG - Intergenic
1120935773 14:89893519-89893541 TGGGAAAGGCCCTCCCTTCAGGG + Intronic
1123018129 14:105385143-105385165 CGGGGAAGCACCTGCTGTCAGGG - Intronic
1123685565 15:22794821-22794843 GGGGCAATGACCTCATGTCAGGG - Intronic
1124342745 15:28900718-28900740 TGGGACAGGACATCCTGACAGGG - Intronic
1125722858 15:41853457-41853479 AGGGAAGGGAGCTGTTGTCAGGG + Intronic
1125744862 15:41991165-41991187 AGGGAAAGGGGCTCCTGTCCTGG + Intronic
1126724887 15:51622387-51622409 GGGGCAGGGACCTCCTGTCCAGG - Intronic
1127976162 15:63998668-63998690 ACGGAAAGCACCTACTGTTACGG - Intronic
1128555678 15:68630183-68630205 AGGGAAAAAATCTCCTTTCAAGG + Intronic
1131735591 15:95327908-95327930 AGGTAAAGCATCTCCTGTCGAGG + Intergenic
1135706359 16:24678454-24678476 ATGGAAAGGCCCACCTGGCAAGG + Intergenic
1139047376 16:63078039-63078061 AGGGAAAGGAACTCCCATGAGGG + Intergenic
1139239280 16:65374017-65374039 AGGAAAAGGAACTCCTTTAAGGG + Intergenic
1139532079 16:67547329-67547351 AGGGAAGGGACTTGCTGTCTTGG - Intergenic
1141133469 16:81450442-81450464 AGGGAGAGCACCTCATGTCTAGG + Intronic
1141933418 16:87219844-87219866 AGGGAGAGGACATTCTGTCCCGG - Intronic
1142249195 16:88983359-88983381 TGGGGAAGGCCCTCCTGTCCGGG - Intergenic
1142425741 16:90001377-90001399 AGTGAAAGCACCTCCAGCCAAGG - Intergenic
1143082911 17:4394704-4394726 AGGGCAATGACCTCCTGGCCTGG - Intergenic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1144711210 17:17402754-17402776 TGGGAATGGAGTTCCTGTCAGGG + Intergenic
1145102353 17:20087712-20087734 AGGTAAAGGCCCTGCTATCACGG + Intronic
1145261195 17:21355777-21355799 AAGGAAAGGACGGCCTGTTACGG - Intergenic
1146272242 17:31492072-31492094 AGGGACAGGTCCTGCTCTCAAGG + Intronic
1146668463 17:34720627-34720649 AGAGAAAGGCACTCCTGGCAGGG + Intergenic
1148620347 17:49030047-49030069 GGGGAAAGGATTTCCTGTCTTGG - Intronic
1150457404 17:65317933-65317955 AGGCCACGGACCTCCTGTCTAGG - Intergenic
1153915144 18:9738397-9738419 AGGGAAGGGACCTCCAGGGAAGG + Intronic
1153922058 18:9800545-9800567 AGGGAAAGAACTCCCTGCCAAGG - Intronic
1154004484 18:10515398-10515420 AGAGAAAGGTCCTTCTCTCATGG - Intergenic
1156376513 18:36519615-36519637 TGGGCAAGGAGCTCCTGCCAGGG + Intronic
1157602502 18:48902544-48902566 AAGGCAAGGACTTGCTGTCAGGG + Intergenic
1165404684 19:35622405-35622427 AGGGACAGGTCCTCATCTCAAGG + Intronic
925231116 2:2234940-2234962 AGGGAAAGGACCGCAGGCCAAGG - Intronic
926773174 2:16396436-16396458 AGGGAAAATCCCTCCTGTGATGG + Intergenic
930268329 2:49226364-49226386 AGGGAAAGAATCAGCTGTCAAGG + Intergenic
931021342 2:58047416-58047438 AGGGAAACGACAGCCTCTCAGGG - Intronic
934908652 2:98229576-98229598 AGAGAAAGGAACTCCTGCCTTGG - Intronic
935361534 2:102250435-102250457 CAGGAAAGGGCTTCCTGTCACGG + Intergenic
936765900 2:115848329-115848351 TGGTATAGGACCTTCTGTCAAGG + Intergenic
937390546 2:121482211-121482233 GGGGCAAGGAACTCCTGACAGGG + Intronic
942617715 2:177811636-177811658 AGGGAAAGGACTGCCTTGCATGG + Intronic
942697773 2:178665082-178665104 AGGGGGAGCACCTCCTCTCAAGG - Intronic
947009075 2:225546393-225546415 ATGGAAAGGACATTCTCTCATGG - Intronic
1170778434 20:19401630-19401652 AGGGTGAGGACCTCCAGGCAGGG - Intronic
1170921174 20:20681108-20681130 AGGGACATGACTTCCTGTTACGG + Intronic
1171249243 20:23636184-23636206 AGGGAATGGCCCTCCTGTGCAGG + Intronic
1171334813 20:24374036-24374058 AGGGAGAGGACCTCCATTCTAGG - Intergenic
1175010046 20:55725808-55725830 AAGGAAGGGGCCACCTGTCAAGG - Intergenic
1176052013 20:63124848-63124870 AGGGGACGGTCCTCCTGGCAGGG - Intergenic
1178327992 21:31660523-31660545 AGGAAAAGGACCTCTGTTCAAGG - Intronic
1180600653 22:17013037-17013059 TGGGACAGGACCTCCTGAGAAGG + Intergenic
1180638826 22:17281845-17281867 AGGCAATGGACTTACTGTCATGG - Intergenic
1181975797 22:26728735-26728757 ACGGAATGGACCAGCTGTCAAGG - Intergenic
1183704244 22:39467217-39467239 AGGGCAAAGACTTCATGTCAGGG - Intronic
1184605140 22:45568609-45568631 AGGGAATGCTCCTCCTGTAAGGG + Intronic
1184605171 22:45568771-45568793 AGGGAATGCTCCTCCTGTAAGGG + Intronic
949960183 3:9305344-9305366 AAAGAGAGGACCTCCTGTGAGGG - Intronic
950707163 3:14790041-14790063 AGGGACAGGACCTCGGCTCAGGG + Intergenic
953696915 3:45166856-45166878 AGGGTAAGGACATCCTGAGAAGG + Intergenic
953843748 3:46410425-46410447 AAGGAAAGTGCCTCCTGTGAAGG - Intronic
954701521 3:52453201-52453223 AGAGCAAGGACATCCTGGCATGG - Intronic
955555260 3:60130161-60130183 AGGGAAAGGTCCCCATGTCTGGG + Intronic
955700818 3:61680327-61680349 AGGGAGAGGGCCTCATCTCAGGG + Intronic
961741725 3:129037151-129037173 AGGGAAAGGAGCTCTTGGGAGGG + Intronic
961768715 3:129232267-129232289 CAAGAGAGGACCTCCTGTCATGG - Intergenic
962845305 3:139268748-139268770 AGGGAAAGGCACTCCAGACAGGG - Intronic
963016615 3:140829867-140829889 AGGCAAAGCACTTGCTGTCATGG - Intergenic
966983794 3:185161618-185161640 AGGGAAAGGCCCACATGGCAAGG + Intergenic
968080095 3:195839921-195839943 AGGGGAAGCAGCTCCTGACAGGG - Intergenic
968533589 4:1109973-1109995 AGGGAGGGGACCTACTGTCAAGG - Intronic
969150795 4:5167067-5167089 AGGGAAAGGGAATCCTGTAACGG - Intronic
970147945 4:13056693-13056715 AGGCAAAGTAGCTCCTATCAAGG + Intergenic
972332927 4:38080435-38080457 AGGAAAAGGGCCTCCTGTGCTGG - Intronic
972338861 4:38133345-38133367 TGGGAAAGGTCCTCTGGTCATGG - Intronic
972407520 4:38761176-38761198 AGGGAAAGAACCTACTGGGAAGG - Intergenic
972750324 4:41981718-41981740 CGGAAAAGAACATCCTGTCACGG + Exonic
973822052 4:54670504-54670526 ACTGCAAGGACCTGCTGTCAGGG + Intronic
978021921 4:103824805-103824827 TGGGAAAGGACCACATGGCAAGG + Intergenic
984536117 4:180977700-180977722 AGGGACAGGGCCTCTAGTCAGGG + Intergenic
986778634 5:11044144-11044166 AGGGAAAGGACCTCCTGTCACGG - Intronic
986911981 5:12568741-12568763 AGGGAAAGCACCTCTTCACAGGG + Intergenic
988769406 5:34416217-34416239 AGGAAAATGACCCCCTTTCAAGG + Intergenic
988923374 5:35964405-35964427 AGGGAAAGCACCCCAGGTCAGGG - Intronic
989358559 5:40572837-40572859 AGGAAAAGGAATTCTTGTCACGG + Intergenic
991633791 5:68682665-68682687 AGGAGAAGGAGCTCATGTCAGGG - Intergenic
997860620 5:137412072-137412094 AGGGGAAGAGCCACCTGTCATGG + Intronic
1001286383 5:170426986-170427008 AGGGAAGAGGCCTCCTTTCAGGG + Intronic
1001596173 5:172900321-172900343 AGGGAGAGGAAGTCCTGGCACGG - Intronic
1001701766 5:173711928-173711950 AGGAATAGGTCCTTCTGTCACGG - Intergenic
1002855640 6:1035689-1035711 AGGGAAGGGACCTCCAGGCGAGG + Intergenic
1003189166 6:3858056-3858078 ATGGAAAGGGCCACCTGGCAAGG + Intergenic
1004015654 6:11729498-11729520 AGGGAAAGGCCCTCCTCTCAGGG - Intronic
1006985371 6:38172397-38172419 AGGGCAAGGACCTCATCTCCAGG - Exonic
1009952676 6:70414176-70414198 AGGGTAAGGAGCTCCGGACAGGG - Intronic
1012318171 6:97806975-97806997 AGGGATAGCTTCTCCTGTCAAGG + Intergenic
1014089971 6:117392957-117392979 ATGGGAAAGACCTCCTGTCTGGG - Intronic
1016728133 6:147399196-147399218 AGGCAAAACACCTGCTGTCATGG - Intergenic
1016799195 6:148151932-148151954 AGGGAAAGGAATTCCAGGCAGGG + Intergenic
1017235471 6:152113352-152113374 ATGCAGAGGACCACCTGTCAGGG - Intronic
1018389314 6:163330384-163330406 ATGGAAAGAACCTCCTGGCGTGG - Intergenic
1020652171 7:10889031-10889053 ATTGAAAGGACCACTTGTCAGGG - Intergenic
1020951107 7:14678731-14678753 AGGAAAAGTACCTTCTGTTAGGG + Intronic
1022453052 7:30533819-30533841 AGGAGAAGGCCCGCCTGTCAGGG - Intronic
1022871606 7:34486144-34486166 AGGGAAATGAGCTCTTGTCTGGG + Intergenic
1023913796 7:44573655-44573677 AAGGGAAGGACCTCCTGGCTCGG - Exonic
1023923497 7:44648184-44648206 AGGGACATGGCCTCCAGTCAAGG - Intronic
1027221033 7:76214107-76214129 AGGGAAAAGGCCTCCTGTCTGGG - Intronic
1027438669 7:78194955-78194977 CAGGAAAGGAGCTCCTGTGAAGG + Exonic
1033782469 7:144688782-144688804 AGGGAAAGGTCTTTATGTCAAGG + Intronic
1034324033 7:150213278-150213300 AGGAAAAGGACCTGCTGTTATGG + Intergenic
1034769163 7:153755958-153755980 AGGAAAAGGACCTGCTGTTATGG - Intergenic
1034978191 7:155459800-155459822 ATAGAAAGGACCTTCTCTCAGGG + Intronic
1035089021 7:156289931-156289953 AGGGAAAGGCCCACGTGACAAGG - Intergenic
1036683052 8:10889992-10890014 AGGGAAAGGAGTTCTGGTCAGGG + Intergenic
1037904613 8:22708341-22708363 AGGGAAAGGACCGACTGCCAAGG - Intergenic
1039600651 8:38834290-38834312 AGGGAAAGGCCCACGTGGCAAGG - Intronic
1041863237 8:62538014-62538036 AGGGGAAGCAGCTCCTGGCATGG - Intronic
1042821781 8:72937323-72937345 AGAGAAAGGACCTGCTGCCAGGG + Exonic
1043345607 8:79294500-79294522 AGGGAAAGGACTTCCTCAGAAGG + Intergenic
1043887048 8:85612853-85612875 AGGAAAAGGAAATCCTCTCAGGG + Intergenic
1045320118 8:101075986-101076008 AAGGAAAGTACTTCCTGTAAGGG + Intergenic
1045427267 8:102079469-102079491 AGGATGAGCACCTCCTGTCATGG + Intronic
1045601118 8:103718163-103718185 AGGCAAGGGACATCCTGCCAAGG + Intronic
1045734627 8:105280424-105280446 AGGGAAAGGGCCTCCTCTCAAGG + Intronic
1046766382 8:118074421-118074443 AAGGAAAGGACCGTCTGTCCGGG + Intronic
1047494246 8:125398328-125398350 AGGGAAGGGGGCTCCTCTCATGG + Intergenic
1047535257 8:125713474-125713496 AGGGAAAGGATATCCTGGAAAGG + Intergenic
1048940297 8:139394722-139394744 AGTGAAAGAACATCTTGTCAAGG - Intergenic
1050441911 9:5672948-5672970 AGATAAAGGACATCCTGTCTAGG - Intronic
1051500403 9:17770733-17770755 AAGGAGAGGACCACATGTCAAGG + Intronic
1055189719 9:73502984-73503006 ATGGAAAGGCCCCCATGTCAAGG + Intergenic
1055583682 9:77733616-77733638 AGGGATAGGACATCCTGTGCTGG - Intronic
1056223070 9:84468816-84468838 AGGGATAGGAGCTATTGTCATGG - Intergenic
1058247247 9:102642749-102642771 AGGGAAGGGATCTGATGTCAAGG + Intergenic
1058813537 9:108663721-108663743 AGGAAAAGGACCTGCTGTTGTGG - Intergenic
1060744672 9:126123413-126123435 TGGCCAAGGACCTTCTGTCAGGG - Intergenic
1060900263 9:127250852-127250874 AGGGCCAGGACGTCCTGGCAGGG - Intronic
1188476382 X:30597306-30597328 AGGAAAAGGAGCTCTTGTCTTGG - Intergenic
1190128670 X:47726729-47726751 AGGGCAAGGACCTCGTGGGATGG - Intergenic
1190702057 X:52996328-52996350 AGGGAAAGGGCCATCTCTCAGGG + Intergenic
1195853867 X:109310014-109310036 AGGGCTATGACCTCCTGACACGG + Intergenic