ID: 986784909

View in Genome Browser
Species Human (GRCh38)
Location 5:11105247-11105269
Sequence CAGGATTATCTGAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986784909_986784916 17 Left 986784909 5:11105247-11105269 CCAACCTCCTTCAGATAATCCTG 0: 1
1: 0
2: 3
3: 15
4: 177
Right 986784916 5:11105287-11105309 TTTGGTAATATGTCCTTCGAAGG No data
986784909_986784915 -1 Left 986784909 5:11105247-11105269 CCAACCTCCTTCAGATAATCCTG 0: 1
1: 0
2: 3
3: 15
4: 177
Right 986784915 5:11105269-11105291 GTGGTCTTGGTTTATATGTTTGG 0: 1
1: 0
2: 1
3: 12
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986784909 Original CRISPR CAGGATTATCTGAAGGAGGT TGG (reversed) Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901337259 1:8461719-8461741 CATGATTATCTGAAAGACCTAGG + Intronic
904031701 1:27537140-27537162 CAGGGTTCTCTCATGGAGGTGGG + Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
906237874 1:44222740-44222762 CAGGAGCATCTAAGGGAGGTGGG - Intronic
906581520 1:46939203-46939225 TATGATTATCAGAAGGAGATGGG - Intronic
906602201 1:47139693-47139715 TATGATTATCAGAAGGAGGTGGG + Intronic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
909303236 1:74039352-74039374 CTGGAGTACCTGAAGGAGATGGG + Intronic
915619225 1:157069506-157069528 TAGGATTATCTGGTGGAGATGGG + Intergenic
916195993 1:162223507-162223529 GAGGAATGTCTGAAAGAGGTTGG + Intronic
917062702 1:171057491-171057513 CTGGAATACCTGAAGGAGATGGG + Intronic
917417516 1:174826047-174826069 CAGGACTATTTGAGGGAGGCAGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
917849352 1:179047274-179047296 CAGGATGGTCTGGAGGAGGGAGG - Intronic
918955384 1:191200238-191200260 CTGGAGTACCTGAAGGAGATGGG + Intergenic
921149518 1:212388371-212388393 CAGGATTTTGTGAGGGAGGTAGG - Intronic
921555929 1:216599060-216599082 GAAGATTATCTGAAGGAGATTGG + Intronic
921663103 1:217831250-217831272 CATGATTAAATGAAGAAGGTAGG - Intronic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
922901292 1:229138772-229138794 CAAGTTTCTCTGAAAGAGGTTGG - Intergenic
923842126 1:237684230-237684252 CAGAAATATCTGAACGAGGCCGG - Intronic
1063643769 10:7857963-7857985 CTGAATTATCTGGGGGAGGTAGG + Intronic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1064508232 10:16057978-16058000 AAGGATTATCTAGTGGAGGTGGG + Intergenic
1070536612 10:77383151-77383173 CAGGGTTCTCTGAATGAGGGAGG - Intronic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1074109972 10:110415906-110415928 CAGGCCAATCTGAAAGAGGTAGG - Intergenic
1079339135 11:19597756-19597778 CATTTTTAGCTGAAGGAGGTGGG + Intronic
1080233302 11:30042207-30042229 CAGGAATGTCTGAAGGACCTGGG + Intergenic
1080279315 11:30538561-30538583 AATGTTTCTCTGAAGGAGGTGGG - Intronic
1080452909 11:32393482-32393504 CAGGATTCTCCTAAGAAGGTGGG - Intronic
1080640251 11:34154491-34154513 CAGGAGTATCAGAAGGTAGTGGG - Intronic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1085529545 11:77183339-77183361 CAGGAGTGTCTGAAGAGGGTGGG + Intronic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1089453475 11:118612390-118612412 CAGCATTTTCTGAGGGAGGAGGG - Intronic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1098130510 12:67345247-67345269 CAGGAATGTCTGAGGGAGCTAGG + Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1106652326 13:31704780-31704802 GAAGATTTTATGAAGGAGGTGGG + Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114631283 14:24161046-24161068 CAAGAGTATCTGAGGGAGGCAGG + Exonic
1118530838 14:66703172-66703194 CTGGAATACCTGAAGGAGATGGG + Intronic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1120049778 14:79851836-79851858 AAGGTTTATCTGAAGTACGTTGG - Intronic
1120358950 14:83471240-83471262 CAGTAATATCTGAAGGACTTTGG + Intergenic
1121708902 14:96022256-96022278 CTGGTTTAACTGAAGGAGGTGGG - Intergenic
1122531080 14:102427609-102427631 CAGCATTATCTGAAAGTGGGTGG - Intronic
1128283595 15:66417639-66417661 CAGGATTCCCTGAAGGTTGTTGG + Intronic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1128927918 15:71675656-71675678 GAGGGTTAGATGAAGGAGGTGGG - Intronic
1131422945 15:92322383-92322405 CAGGCTCATCTGAATGAGGAAGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1137745535 16:50817490-50817512 CTGGATTAGCGGCAGGAGGTGGG + Intergenic
1138204884 16:55117330-55117352 GAGGATTCTCTGATGGAAGTGGG - Intergenic
1140720236 16:77764868-77764890 CAGCCTTATCTGATGGAGCTGGG + Intergenic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1142736763 17:1905852-1905874 CAGGAACATCTGAATGAGGGGGG + Intergenic
1144024705 17:11267793-11267815 CAGGCTTATCTGAGAGAGGGAGG + Intronic
1144754664 17:17671810-17671832 CAGGACAACCTGAAGAAGGTGGG + Intergenic
1145129997 17:20336286-20336308 CAGGATTTTCTTTAGGAAGTAGG + Intergenic
1147011534 17:37452971-37452993 CTGGATAATCTGAAGAAGGGAGG - Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151460788 17:74252912-74252934 CAGAATGATCTGCAGGAGGCAGG + Intronic
1155298434 18:24406890-24406912 GAGCATTCTCTGAAGGAGGGAGG - Intergenic
1156661999 18:39357312-39357334 ATGGATTATCAGATGGAGGTTGG - Intergenic
1157636215 18:49157423-49157445 GAGGATTAAATGAATGAGGTAGG - Intronic
1158996287 18:62923494-62923516 CAGGATTATGTGAAGGGGGTGGG + Intronic
1159706468 18:71695634-71695656 CAGGGGCATCTGAAGGATGTCGG - Intergenic
1160342627 18:78102490-78102512 CAGGATGACCTGAAGGCGGGGGG + Intergenic
1160782553 19:884308-884330 CAGGATTTTGTGCCGGAGGTGGG + Intronic
1161059170 19:2206303-2206325 AAGCATTATTTGTAGGAGGTTGG + Intronic
1163003108 19:14381404-14381426 CAGGACTTTATGAAGGAGGGGGG - Intronic
1164584363 19:29457075-29457097 CAGGATTGTCAGGAGGAGATAGG + Intergenic
1165816994 19:38648378-38648400 CAGAAAGATCTGAAGGAGATTGG + Intronic
1167264324 19:48476011-48476033 CAGGCTTCTTGGAAGGAGGTTGG + Intronic
1167572933 19:50301296-50301318 CAGGATCATCTGGGGGAGCTTGG - Intronic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
928429166 2:31203680-31203702 CAGGATTTTCTGAGAGAAGTAGG + Intronic
928644442 2:33337056-33337078 CAGGGTTTTCTAAAAGAGGTTGG - Intronic
928703396 2:33922109-33922131 CAGGATAACCTAAAGGAAGTAGG - Intergenic
929864358 2:45705538-45705560 CAGGCTTATTGGAAGGAGGGAGG + Intronic
931617562 2:64175796-64175818 CAGCATTGTCTGAAGGAGAGGGG - Intergenic
932008265 2:67949382-67949404 CAGGTTTAACTGACAGAGGTTGG - Intergenic
937754805 2:125524236-125524258 CAGGAGTATATGCAGGAGATTGG + Intergenic
939671598 2:145019237-145019259 CATGATTATTTGAAAGAGGAAGG - Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941405445 2:165081632-165081654 CATGAATAACTGAAGGTGGTGGG + Intergenic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
944495595 2:200305115-200305137 GAGGATTACCTGAACCAGGTAGG - Intergenic
944526421 2:200624408-200624430 CAGGTTTCTCTGAAGTAAGTGGG + Intronic
948277965 2:236724649-236724671 GAGGAATATCTGAAGGAAGATGG - Intergenic
948302140 2:236915508-236915530 CAGGAAATTCAGAAGGAGGTTGG - Intergenic
1169496642 20:6122446-6122468 CTGGAATATCTGAAGGTGCTTGG + Intronic
1173464964 20:43273553-43273575 CATGGTTACCTGAAGGAGGGTGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1180097927 21:45569007-45569029 CATGATTGTCTGAAGATGGTGGG + Intergenic
1180576834 22:16784507-16784529 AATGATTTTCTAAAGGAGGTGGG - Intronic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1183069780 22:35387903-35387925 CTGGATTTTCTGAAGGGGGAGGG - Intronic
1184859172 22:47163459-47163481 CAGGTGCATCTGAAGGTGGTAGG + Intronic
950713184 3:14828465-14828487 GAGGATTATATGGAGGAGATGGG + Intronic
956239415 3:67112845-67112867 AAGGATTATCTGCAGGAGCATGG + Intergenic
959348380 3:105228807-105228829 CAGGAATACATGAAGGAAGTGGG - Intergenic
967131930 3:186478541-186478563 CAGGGGTTTCAGAAGGAGGTTGG - Intergenic
967562741 3:190935318-190935340 GAGGATGAACTGAAGCAGGTGGG - Intergenic
967800644 3:193655058-193655080 AAGCATTATCTGAAGGGAGTAGG + Intronic
968332213 3:197880531-197880553 GAGGTTTAGCTGAAGGATGTCGG - Intronic
969049583 4:4363300-4363322 GAGGATTAACTGAAGGATTTAGG + Intronic
970185208 4:13444995-13445017 TAGGATTACCTGAAAGAGATGGG - Intronic
970842042 4:20485057-20485079 CAAGTTCCTCTGAAGGAGGTAGG - Intronic
976608970 4:87009650-87009672 CACAATTATCTGAATGAGCTTGG - Intronic
976985106 4:91284654-91284676 CATGATTATCTGACGGATGCTGG - Intronic
984485361 4:180361169-180361191 TAGTATTATCTGATGGTGGTTGG + Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987581979 5:19805682-19805704 CAGGACTATTTGAAGGTGGTTGG - Intronic
987781529 5:22442688-22442710 GAGGATGATCTGAAGTAGGCAGG + Intronic
987988426 5:25180070-25180092 TTGGATTATCTGAAGGAGGCAGG - Intergenic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989217935 5:38924417-38924439 GAGGGTTGTCTGAAGGAGCTAGG - Exonic
990295264 5:54395415-54395437 CAGGTTTGTCTTAAGGAGTTTGG + Intergenic
991412487 5:66358740-66358762 CAGCATTTGCTGAAGCAGGTTGG + Intergenic
994287369 5:97985639-97985661 CAGGACTATCTGAACGAAATGGG + Intergenic
997389926 5:133506114-133506136 CAGCATTTTCTGTAAGAGGTGGG - Intronic
997629717 5:135357540-135357562 CAGTATTATTTGAAGGAGTTAGG - Intronic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
998530424 5:142879552-142879574 TAAGATTTTCTGAAGAAGGTGGG - Intronic
998985435 5:147751516-147751538 AAGGGTTATGTGAAGGGGGTGGG - Intronic
999019770 5:148152332-148152354 CAGGAAAATATGATGGAGGTGGG + Intergenic
999151150 5:149427096-149427118 CAGGAATGTCTGAAGGGGATGGG - Intergenic
1000028885 5:157384617-157384639 CACCATTTTCAGAAGGAGGTTGG - Intronic
1003248909 6:4407168-4407190 CTGGAGTACCTGAAGGAGATGGG + Intergenic
1005028369 6:21485903-21485925 AAGGATTATCTCAGGGTGGTGGG - Intergenic
1005170773 6:22981832-22981854 CTGGAGTATCTGAAGGAGTCTGG + Intergenic
1012874545 6:104711153-104711175 CAGGCATATGTGAAGGAGGCAGG - Intergenic
1013302911 6:108820907-108820929 CAGGATTATCTGCTGGAGAGTGG - Intergenic
1013933264 6:115561802-115561824 CAAAATTATCTGAAGGCGGATGG - Intergenic
1014002952 6:116385246-116385268 GATGCTTATCTGAATGAGGTGGG + Intronic
1014672873 6:124328925-124328947 CATTATTATCTGAAGCAAGTGGG - Intronic
1016895924 6:149052636-149052658 CATGATTATCTGAGGGAGATGGG + Intronic
1017859472 6:158382061-158382083 CAGGAGTATGGGGAGGAGGTAGG + Intronic
1017891692 6:158644572-158644594 CTGGCCTAGCTGAAGGAGGTGGG + Intronic
1018358801 6:163045027-163045049 CTGGAGTATCTCAAGGAGGTAGG + Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1026400955 7:70012235-70012257 CAGGATTGGCTGGAGGAGGCAGG + Intronic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1028545099 7:91989490-91989512 CAGGGTTATTTGGAGGAAGTTGG + Intronic
1031634996 7:124091795-124091817 CAGGATAATCTGAAGGTGGGAGG - Intergenic
1035425078 7:158765214-158765236 CATGCTTATCTCAAGGAGGCTGG + Intronic
1035786818 8:2267868-2267890 CAGGGTTATCTGCAGGAGACAGG - Intergenic
1035805989 8:2453848-2453870 CAGGGTTATCTGCAGGAGACAGG + Intergenic
1036716338 8:11127681-11127703 CAGGATTATCTGGGTAAGGTGGG - Intronic
1038696868 8:29813952-29813974 TAGGATTACCTGAAGGATGGTGG + Intergenic
1039477887 8:37850397-37850419 CAGGAATGTCTAAAGGAGTTTGG + Intergenic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1043467646 8:80528267-80528289 CAGGATTATTTGATGTATGTAGG + Intergenic
1045832759 8:106483820-106483842 CAAGGTTATCTGGGGGAGGTTGG - Intronic
1046347996 8:112961907-112961929 CAGGATTATATGAAAAATGTGGG + Intronic
1049378905 8:142302369-142302391 CAGGAGGATCTGACAGAGGTGGG + Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1049895184 9:106116-106138 GAACAATATCTGAAGGAGGTGGG - Intergenic
1050039053 9:1469169-1469191 TAGGATTCTCTGCAGGATGTGGG + Intergenic
1051882518 9:21854428-21854450 CAGGATTATGTGAATGAGAAAGG + Intronic
1052769727 9:32676518-32676540 CATGTTGCTCTGAAGGAGGTTGG + Intergenic
1053737684 9:41111855-41111877 GAACAATATCTGAAGGAGGTGGG - Intergenic
1053738352 9:41116216-41116238 GAACAATATCTGAAGGAGGTGGG - Intergenic
1054689998 9:68315099-68315121 GAACAATATCTGAAGGAGGTGGG + Intergenic
1054690665 9:68319464-68319486 GAACAATATCTGAAGGAGGTGGG + Intergenic
1055612857 9:78041126-78041148 CGGGTTGATCTGCAGGAGGTTGG + Intergenic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1061767743 9:132892527-132892549 CAAGAGTATCCGCAGGAGGTGGG + Exonic
1187859824 X:23670388-23670410 CAGGATTATATATATGAGGTAGG + Intronic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1190728483 X:53208479-53208501 AAGGATTCTCTGAAGGATTTGGG - Intronic
1194414250 X:93591043-93591065 TAGGATTATCTGGAGGTGGGGGG - Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1196873461 X:120135492-120135514 CAGGCTTCTGTGAAGGAGCTGGG + Intergenic
1196902690 X:120401437-120401459 CCTGATTATCAGGAGGAGGTAGG + Intergenic
1197363175 X:125532534-125532556 CAGGAATATCTGTGGTAGGTTGG - Intergenic
1201424570 Y:13833996-13834018 CAGGATGAAATGAACGAGGTGGG + Intergenic
1201765585 Y:17571058-17571080 CAGGATTAACTGAATGAGTGTGG - Intergenic
1201835967 Y:18334931-18334953 CAGGATTAACTGAATGAGTGTGG + Intergenic
1201852974 Y:18508480-18508502 AATTATTTTCTGAAGGAGGTGGG + Intergenic
1201880347 Y:18811904-18811926 AATTATTTTCTGAAGGAGGTGGG - Intronic