ID: 986785734

View in Genome Browser
Species Human (GRCh38)
Location 5:11112360-11112382
Sequence CCGGATCTGAAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 363}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986785734 Original CRISPR CCGGATCTGAAGATGGTGGA AGG Intronic
900207644 1:1438406-1438428 CCGGGTCTGAGGGTGGGGGATGG + Intronic
900937931 1:5778770-5778792 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
901037907 1:6347299-6347321 CCGGATCTGGGGCTGCTGGAGGG - Intronic
901152167 1:7111076-7111098 CTGGCTCTCAAGATGGGGGAAGG - Intronic
902275787 1:15338355-15338377 CTGGCTTTGAAGATGGAGGAAGG - Intronic
902293596 1:15451105-15451127 CTGGCTCTGAAGATAGAGGAAGG + Intergenic
903090795 1:20914412-20914434 CTGGCTTTGAAGATGGAGGAAGG + Intronic
903757450 1:25672510-25672532 CTGGCTTTGAAGATGGAGGAAGG - Intronic
905315252 1:37078833-37078855 CCTGATCTCAGGATGGGGGAAGG - Intergenic
906837218 1:49096907-49096929 CTGGCTCTGAAGATGAAGGAAGG + Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908096783 1:60747630-60747652 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
909188755 1:72524256-72524278 TCAGCTTTGAAGATGGTGGAAGG + Intergenic
910144774 1:84067025-84067047 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
910802433 1:91159574-91159596 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
910961650 1:92770025-92770047 CTGGGTTTGAAGATGGAGGATGG + Intronic
912125152 1:106527164-106527186 CTGGCTTTGAAGATAGTGGAAGG - Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
916094226 1:161334207-161334229 CTGGTTCTGAAGATGGAGGAAGG - Intronic
916704882 1:167339108-167339130 CTGGCTTTGAAGATGGAGGAAGG - Intronic
916930757 1:169576014-169576036 CTGGTTTTGAAGATGGAGGAAGG + Intronic
917214702 1:172665828-172665850 CAGGATCTGGTGATGATGGAGGG + Exonic
918370556 1:183857202-183857224 CTGGCTTTGAAGATGGAGGAAGG + Intronic
922120867 1:222666219-222666241 CCAGAACTGAAGATGGTGGCTGG + Exonic
922511953 1:226176104-226176126 GTGGCTCTGAAGATGGAGGAAGG + Intronic
922889129 1:229046911-229046933 GGGGATCTGATGATGGGGGAAGG - Intergenic
922967338 1:229701618-229701640 CCAGCTTTGAAAATGGTGGAAGG + Intergenic
924582103 1:245331439-245331461 GCGGATCTGAAAATGGGTGAAGG + Intronic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1066575665 10:36821536-36821558 ACGGATTTGAACATGTTGGAAGG + Intergenic
1067209993 10:44252108-44252130 CCAGATCTGAAGAATGAGGATGG + Intergenic
1067599596 10:47586200-47586222 CCTGATCAGTATATGGTGGACGG - Intergenic
1067699862 10:48563056-48563078 CTGGCTTCGAAGATGGTGGAAGG - Intronic
1069310091 10:67024196-67024218 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1069586236 10:69604658-69604680 CTGGTTCTCAATATGGTGGATGG - Intergenic
1070261171 10:74857366-74857388 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1070448916 10:76537572-76537594 CTGGCTCTGAAAATGGAGGAAGG - Intronic
1071309020 10:84326210-84326232 CAGGTTTTGAAGATGGAGGAAGG + Intergenic
1071573746 10:86711574-86711596 CCGGATCCGAAGAGCCTGGAGGG - Intronic
1071651122 10:87394084-87394106 CCTGATCAGTATATGGTGGACGG - Intergenic
1071668764 10:87587395-87587417 CCGGCTTTGAAGATGGCAGAGGG + Intergenic
1071979300 10:90987565-90987587 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072910511 10:99496847-99496869 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074153175 10:110776530-110776552 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1074202995 10:111256435-111256457 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074702654 10:116106085-116106107 CTGGTTCTGAAAATGGAGGAAGG + Intronic
1075272513 10:121064658-121064680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1075480526 10:122777743-122777765 CCGGAGCTGCAGCTGGTGGGTGG + Intergenic
1075951434 10:126481131-126481153 CAAGATCTGCAGATGATGGAAGG - Intronic
1076071328 10:127492338-127492360 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1076292445 10:129357147-129357169 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1077537557 11:3131754-3131776 ATGGATGGGAAGATGGTGGATGG - Intronic
1078919278 11:15813265-15813287 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079685548 11:23354862-23354884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1080247890 11:30199977-30199999 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1080709737 11:34735149-34735171 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1081501185 11:43668289-43668311 GCTGGTCTGAAGATGGAGGACGG - Intronic
1081575097 11:44314222-44314244 CCAGCTCTGCAAATGGTGGAAGG + Intergenic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1085038463 11:73313299-73313321 CCAGTTCTGAAGGTGGGGGAGGG + Intronic
1086055996 11:82647105-82647127 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1091662286 12:2393365-2393387 CTGGAGCAGGAGATGGTGGAGGG - Intronic
1092654559 12:10671488-10671510 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093338840 12:17946182-17946204 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1094493537 12:30975942-30975964 CCGTAGCTGAGGATGGTGGAGGG + Intronic
1094732087 12:33188611-33188633 CTGGATTTTAAGATGGAGGAGGG + Intergenic
1095236487 12:39802322-39802344 ACGTATGTGAAGATGGTGGAAGG + Intronic
1095476428 12:42590731-42590753 CCGGAACTGGAGAGGGTGGGGGG - Intergenic
1095907403 12:47392045-47392067 CCGGATCTCAAGGAGGTGGGTGG - Intergenic
1097290573 12:57911042-57911064 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097429851 12:59491436-59491458 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1100714657 12:97293326-97293348 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1101434729 12:104654882-104654904 CCTGTTCTGGAGATGGGGGAGGG - Intronic
1103799423 12:123527808-123527830 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1103989209 12:124786868-124786890 CCGAATCTGAAGTGGGTTGATGG - Intronic
1104166837 12:126239889-126239911 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1104567982 12:129902724-129902746 GCGGCTCTGAAGAAGGGGGATGG - Intronic
1104695178 12:130858055-130858077 CTGGCACTGAAGATGGAGGATGG - Intergenic
1105811149 13:23996798-23996820 CTGGCTCTGGAGATGGAGGAGGG - Intronic
1106374879 13:29176603-29176625 CCATATCTTCAGATGGTGGAAGG + Intronic
1106454725 13:29917133-29917155 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1107630352 13:42336347-42336369 CCGGCTTTGAAGAGGGAGGAAGG + Intergenic
1107884932 13:44867350-44867372 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1108698906 13:52927015-52927037 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1109491373 13:63104865-63104887 CTGGCTCTGAAGATGGTGGAAGG - Intergenic
1110408386 13:75176278-75176300 CTGGCTTTGAAGATGGAGGATGG + Intergenic
1110574449 13:77039772-77039794 TCGGCTTTGAAGATGGAGGAAGG - Intergenic
1112171674 13:96978830-96978852 CCGGCTCTGAAGATAGGTGAAGG + Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112789064 13:102983543-102983565 CAGGAGCTGATGATGTTGGAGGG + Intergenic
1113144038 13:107187021-107187043 CTGGATTTTAAGATGGAGGAAGG - Intronic
1113283333 13:108815477-108815499 GCTGCTTTGAAGATGGTGGAAGG + Intronic
1113976291 13:114230212-114230234 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1118315013 14:64720865-64720887 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1120728814 14:87978726-87978748 TAGGATCTGAGGATAGTGGATGG - Intronic
1120836540 14:89042898-89042920 CTGGCTTTGAAGATGGAGGACGG + Intergenic
1121290781 14:92773265-92773287 CTGGATCTGACGATGGAGGGAGG - Intergenic
1121717009 14:96083582-96083604 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1122420927 14:101576886-101576908 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1124218909 15:27832464-27832486 ATGGCGCTGAAGATGGTGGAAGG - Intronic
1127210684 15:56771643-56771665 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130672819 15:85927890-85927912 CTGCATCAGAATATGGTGGAGGG + Intergenic
1130984392 15:88835246-88835268 CTGGATTTGAAGTTGGTGGCAGG + Intronic
1131396224 15:92088694-92088716 CTGGCTTTGAAGATGGTGGATGG - Intronic
1131771488 15:95742689-95742711 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1131940387 15:97558417-97558439 CTAGATTTGAAGATGGAGGAAGG - Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1132319245 15:100913439-100913461 CTGGCTTTGAAGATGGAGGATGG - Intronic
1132810579 16:1794810-1794832 CCGGAGCTGAGGATGGGGTAGGG - Intronic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1133467509 16:6042025-6042047 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1135424440 16:22325349-22325371 CCGGACCTGGAGAGGGTGGAGGG + Intronic
1135527037 16:23221463-23221485 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1137237265 16:46626160-46626182 TGGAATGTGAAGATGGTGGAGGG + Intergenic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1137737403 16:50735199-50735221 CTGGCTCTGAAGGTGGAGGAAGG + Intergenic
1138544191 16:57706296-57706318 CTGGATCAGAGGATGGTGGGAGG - Intronic
1138756902 16:59498118-59498140 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1140051632 16:71486491-71486513 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1141149206 16:81552539-81552561 GTGGCTCTGAAGATGGAGGAAGG - Intronic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1141788199 16:86215771-86215793 TCGGCTCTGAAGATGGAGGAGGG - Intergenic
1142000410 16:87661153-87661175 CTGGCTCTGAAGGTGGAGGAGGG - Intronic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142198044 16:88747869-88747891 CCGGCTCTGGAGATGGAGGGAGG + Intronic
1142947617 17:3446056-3446078 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1146753215 17:35401058-35401080 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1147686932 17:42291781-42291803 CCAGATATGAAGATCTTGGAGGG + Intronic
1149018224 17:51933391-51933413 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1149383180 17:56114897-56114919 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1151189782 17:72389722-72389744 CTGGCTTTGAAGATGGTGGAAGG - Intergenic
1153557447 18:6330435-6330457 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1153993652 18:10421648-10421670 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1155758047 18:29526609-29526631 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1157335430 18:46734031-46734053 CTGGACCTGGGGATGGTGGAGGG - Intronic
1160737930 19:673067-673089 CGGGATTTGGAGATGGAGGAAGG - Intergenic
1160858360 19:1227373-1227395 CGGGCTCTGACGCTGGTGGATGG - Intronic
1161578418 19:5067463-5067485 CGTGCTCTGAAGATGGTAGAAGG + Intronic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162795494 19:13085346-13085368 CAGGCTCTGAAGCTGGAGGAAGG + Intronic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1164638406 19:29807839-29807861 CAGGCTCTGATGATGGAGGACGG - Intergenic
1166321154 19:42019716-42019738 CTGGTTCTGAAGATGGAGGAAGG + Intronic
1166422681 19:42651070-42651092 CTGTATCTGCACATGGTGGAGGG - Intronic
1166510617 19:43406481-43406503 CGGGAACTGAAGATGGAGGCGGG - Exonic
1168189378 19:54726734-54726756 CGGGCTTTGAAGATGGGGGAAGG + Intronic
1168417342 19:56176874-56176896 CCTGATCCGATGATGGGGGAAGG + Intronic
927716741 2:25358144-25358166 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928815685 2:35292311-35292333 CCAGCTCTGATGAGGGTGGAAGG + Intergenic
931191955 2:60010218-60010240 CCGGCTTTGAAAATGGAGGAAGG + Intergenic
931500263 2:62856985-62857007 CTGGCTTTGAAGATGGAGGAAGG + Intronic
932512730 2:72311425-72311447 CTGGTTTTGAAGATGGAGGAAGG - Intronic
932849273 2:75168478-75168500 CTGGCTTTGAAGATGGAGGAAGG + Intronic
933174128 2:79157601-79157623 CCGGGGCTTGAGATGGTGGAGGG + Exonic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
935296795 2:101656733-101656755 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
935391582 2:102558758-102558780 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
935725867 2:106023598-106023620 CTGGCTCTGAAGGTGGAGGAAGG - Intergenic
936778221 2:115999625-115999647 CTGCATCTTAACATGGTGGAAGG + Intergenic
937160304 2:119754853-119754875 CTAGGTTTGAAGATGGTGGAAGG + Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
937966962 2:127519889-127519911 CTGGTTTTGAAGATGGAGGAAGG + Intronic
940214228 2:151288380-151288402 CTGGCCCTGAAGATGGAGGAAGG + Intronic
940385439 2:153065766-153065788 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
940556920 2:155240543-155240565 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
942889231 2:180966757-180966779 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
944501410 2:200364082-200364104 CAGGCTTTGAAGATGGGGGAAGG + Intronic
945061798 2:205915818-205915840 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
946427498 2:219607036-219607058 TCGGCTCTGAGGTTGGTGGAGGG - Exonic
947361688 2:229351792-229351814 CAGAATCTGCATATGGTGGAAGG + Intergenic
948036944 2:234865389-234865411 CTGGCTCTGACGATGGAGGAAGG - Intergenic
948051717 2:234983761-234983783 CGAGCTTTGAAGATGGTGGAGGG + Intronic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948345799 2:237297093-237297115 CTGGCTCTGAAGGTGGAGGAAGG - Intergenic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
949037422 2:241822232-241822254 CTGGGTTTGAAGATGGAGGAGGG + Intergenic
1170045880 20:12084948-12084970 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1170402408 20:16002567-16002589 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1170866460 20:20162131-20162153 CCAGCTCTGAAGATGGAGGAAGG - Intronic
1172181340 20:33005556-33005578 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173162923 20:40665652-40665674 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1173554055 20:43953052-43953074 ACGGCTATGAAGATGGAGGAAGG + Intronic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173796033 20:45860599-45860621 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1174115185 20:48222011-48222033 CTGCATCAGAACATGGTGGAAGG + Intergenic
1174505662 20:51015906-51015928 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1174539779 20:51279845-51279867 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175287366 20:57845851-57845873 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1175385432 20:58591958-58591980 CCGACTCTGAAGGTGGAGGAAGG + Intergenic
1175434255 20:58931534-58931556 CTGTATCTGTACATGGTGGAAGG - Intergenic
1175870411 20:62206678-62206700 CCGGCTCTGAAGGTGGAGGGTGG + Intergenic
1175997701 20:62818855-62818877 CTGGAACTGAAGAAGGTGGGAGG - Intronic
1176046467 20:63095362-63095384 CTGGCTCTGAAGACGGAGGATGG + Intergenic
1176991969 21:15507878-15507900 CTGCATCATAAGATGGTGGAAGG - Intergenic
1177318415 21:19491077-19491099 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1178751512 21:35308610-35308632 CCGGCTTTGAGGATGGAGGAAGG - Intronic
1179154876 21:38841003-38841025 CTGGCTCTCAGGATGGTGGAAGG - Intergenic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1180196197 21:46195784-46195806 CCGGCTGTGAACAGGGTGGAAGG - Intronic
1180636594 22:17266938-17266960 CCGGATCTGAAGGCCTTGGAAGG + Intergenic
1181438634 22:22924456-22924478 CAGGCTCTGAAGTTGGAGGAAGG - Intergenic
1182064882 22:27423683-27423705 CTGGAGTTGAAAATGGTGGATGG - Intergenic
1182517314 22:30866279-30866301 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184529266 22:45044119-45044141 TGGGATTGGAAGATGGTGGAAGG + Intergenic
950921584 3:16700277-16700299 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
951051378 3:18097707-18097729 CTGGCTTTGAAGATGGAGGAAGG - Intronic
951110130 3:18793392-18793414 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952190466 3:31017774-31017796 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
953260696 3:41336336-41336358 ACGTATCTGAAAATGATGGAGGG + Intronic
953379445 3:42456465-42456487 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
953501880 3:43444345-43444367 GCAGATCTGATGATGGTGAAAGG + Intronic
954623731 3:52010750-52010772 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
954732000 3:52672191-52672213 CTGGCTTTGAAGATGGAGGAAGG - Intronic
955413172 3:58668994-58669016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
956282643 3:67574075-67574097 CTGGCTTTGAAAATGGTGGAAGG - Intronic
957032517 3:75258079-75258101 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
957764610 3:84606622-84606644 CTGAAACTGATGATGGTGGAAGG + Intergenic
958525934 3:95259006-95259028 CAGGGTCTGAAGTTGGGGGAAGG - Intergenic
959322031 3:104888780-104888802 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
961578143 3:127855423-127855445 CTGGCTCTGAAGATGGAGGGAGG - Intergenic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
961750384 3:129090852-129090874 TGGAATGTGAAGATGGTGGAGGG + Exonic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963617467 3:147559824-147559846 CTGGATTTGAAGGTGGAGGAAGG - Intergenic
964561083 3:157997323-157997345 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
964655951 3:159066379-159066401 CCTGATCATAACATGGTGGAAGG - Intronic
965555938 3:170018468-170018490 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
966323435 3:178727625-178727647 CTGGCTTTGAAGATGGAGGAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967346930 3:188467728-188467750 CTGGCTTTGAAGATGGAGGAAGG + Intronic
968041018 3:195589376-195589398 TCTGCTCTGATGATGGTGGAGGG + Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
969627687 4:8316148-8316170 CCGCATCTGGAGGTGGGGGAGGG - Intergenic
970328635 4:14955690-14955712 CCAGAGCTGAAGATGGAGGCAGG + Intergenic
970398251 4:15692896-15692918 CTGGCTCTGAAGATGCAGGAAGG - Intronic
970774099 4:19652236-19652258 CGGGCTTTGAAGATGGAGGAGGG - Intergenic
970821882 4:20226272-20226294 CTGGCTTTGAAGATGGAGGATGG + Intergenic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
971454925 4:26835227-26835249 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
971795335 4:31219683-31219705 CCGGCTTTGAAGATGGAGAAAGG - Intergenic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
972247915 4:37265593-37265615 CTGGCACTGAAGATGGAGGAAGG - Intronic
972761026 4:42104592-42104614 CTGGTTTTGAAGATGGAGGAAGG - Intergenic
972791430 4:42374957-42374979 CTGGCTTTGAAGATGGCGGAAGG - Intergenic
974950176 4:68577475-68577497 CCGGCTGGGAAGATGGTGGCTGG - Intronic
975280649 4:72558373-72558395 CTGGTTCTGAGGATGGAGGAAGG - Intronic
975417684 4:74124181-74124203 CAGGATCTTAAGATGGTCTAGGG - Intronic
976223782 4:82779309-82779331 CTGGCTTTGAAGATGGAGGAAGG + Intronic
976392583 4:84520675-84520697 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
976650636 4:87430153-87430175 CTGGCTTTGAAGATGATGGAAGG + Intronic
977334807 4:95684395-95684417 CTGGGTGTGAAGATGGGGGAAGG + Intergenic
979503706 4:121468943-121468965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
980082318 4:128357185-128357207 CTGGCTTTGAAGATGGAGGAGGG + Intergenic
981348136 4:143699444-143699466 CTGGAGCTGGAGGTGGTGGACGG - Exonic
981661771 4:147175638-147175660 CTGGCTTTGAAGATGGTGGGAGG + Intergenic
982106520 4:152016205-152016227 CGGCATCTGATGAGGGTGGAAGG - Intergenic
982525980 4:156478775-156478797 CTGGCTTTGAAGATGGTGGATGG + Intergenic
983523572 4:168736671-168736693 CCTGATGTTCAGATGGTGGATGG - Intronic
986013860 5:3740677-3740699 GCGGCGCTGAAGATTGTGGAGGG - Intergenic
986239846 5:5951279-5951301 CCTGCTCTGGAGTTGGTGGAGGG + Intergenic
986785734 5:11112360-11112382 CCGGATCTGAAGATGGTGGAAGG + Intronic
987103231 5:14611402-14611424 CTGGCTTTGAAGATGGAGGAAGG + Exonic
987385482 5:17325110-17325132 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
989725806 5:44585053-44585075 TTGCATTTGAAGATGGTGGATGG + Intergenic
990605618 5:57406949-57406971 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
990659884 5:58001549-58001571 CCGGATGTGAACATGGAGTAAGG - Intergenic
990930396 5:61083583-61083605 CAGGATCTCAACATGGTGAAAGG - Intronic
991473617 5:66996680-66996702 CTGGGCCTGAAGATGGAGGAAGG - Intronic
992647871 5:78829014-78829036 CTGGCTTTGAAGATGGAGGAAGG + Intronic
993411174 5:87575003-87575025 CTGGTTTTGAAGATGGAGGAAGG + Intergenic
994250669 5:97533171-97533193 CCAGATCTGAAGATGAAGGAGGG - Intergenic
995060156 5:107804862-107804884 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995572565 5:113495740-113495762 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
995783519 5:115803260-115803282 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996418265 5:123233481-123233503 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996470427 5:123853624-123853646 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996819012 5:127605156-127605178 CTGGTGCTGAAGATGGTGGAAGG - Intergenic
996857897 5:128030567-128030589 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
996960956 5:129249083-129249105 CCGGCTTTGAAGATGTAGGAAGG - Intergenic
999361892 5:150992540-150992562 CCGGAGCTGAAGGAGGAGGAGGG + Intergenic
999966568 5:156816580-156816602 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
1000248272 5:159468468-159468490 CCGGCCTTGAAGATGGAGGAAGG + Intergenic
1001233910 5:170013528-170013550 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1001658161 5:173369983-173370005 CTGGCTTTGAAGATGGAGGATGG - Intergenic
1002159285 5:177305536-177305558 CCAGAGCTGCAGCTGGTGGAAGG + Intronic
1002447690 5:179299724-179299746 CTGGCTTTGAAGATGGAGGAGGG - Intronic
1003133135 6:3412826-3412848 CTGGCTCTGAAGACGGAGGATGG + Intronic
1008141697 6:47839464-47839486 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1009965829 6:70577077-70577099 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1010170185 6:72966053-72966075 CAGGACCTGATGGTGGTGGATGG - Intronic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1012018197 6:93880444-93880466 CTGCATCTGAGGGTGGTGGATGG + Intergenic
1013622279 6:111901468-111901490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1013993605 6:116281203-116281225 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1014451983 6:121592399-121592421 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1015070370 6:129086943-129086965 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1016341322 6:143064350-143064372 CTGGGTTTGAAGATGGAGGATGG + Intronic
1016355050 6:143209539-143209561 CTGGTTCTGAAGATGGAGGAGGG + Intronic
1017809985 6:157977609-157977631 CCAGACCTGCACATGGTGGAAGG - Intergenic
1018209772 6:161469625-161469647 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1019288065 7:233609-233631 CCGGCTCTCAGGATGGAGGAGGG - Intronic
1019581467 7:1765647-1765669 TGGGCTCTGAAGATGGAGGAAGG + Intergenic
1020727256 7:11831715-11831737 CCAGATGTGAAGATGGGGAAAGG + Intronic
1021787713 7:24169021-24169043 CTGGCTTTGAAGATGGAGGAGGG - Intergenic
1021881042 7:25095794-25095816 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023030658 7:36087982-36088004 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1023994687 7:45152045-45152067 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1025194925 7:56925278-56925300 CAGGACCAGAAGAGGGTGGAGGG - Intergenic
1025677027 7:63651665-63651687 CAGGACCAGAAGAGGGTGGAGGG + Intergenic
1026654934 7:72248451-72248473 CTGACTTTGAAGATGGTGGAAGG - Intronic
1027215961 7:76184129-76184151 CTAGCTCTGAAGATGGAGGAGGG + Intergenic
1027428835 7:78088991-78089013 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1029531835 7:101130519-101130541 CGGGATCTGAAGCTGGTCCAGGG + Exonic
1030360534 7:108590628-108590650 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1031551639 7:123121253-123121275 CCAGAGCTGAATATGGAGGATGG - Intronic
1031647829 7:124248602-124248624 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1032016510 7:128383580-128383602 CTGGTTCTGAAGATGGAGGAAGG + Intergenic
1032603061 7:133320395-133320417 CTGGTTTTGAAGATGGAGGAAGG - Intronic
1035653190 8:1284280-1284302 CCTGTGCTGAAGATGATGGAAGG + Intergenic
1036189833 8:6660300-6660322 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1036282276 8:7410742-7410764 CTGGATTTGAAGATGAAGGAAGG - Intergenic
1036339192 8:7900828-7900850 CTGGATTTGAAGATGAAGGAAGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1037438405 8:18888998-18889020 CCCCATGTGAAGATGGTGGGTGG - Intronic
1037443883 8:18945386-18945408 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1037998889 8:23373765-23373787 CAGGATCTGAAGGTGGTGGCAGG + Intronic
1038410551 8:27355374-27355396 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1041337339 8:56801100-56801122 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1042773299 8:72402225-72402247 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1042985658 8:74580279-74580301 CTGGCTCTGAAGATGGAGGGGGG - Intergenic
1044875218 8:96658746-96658768 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1045321102 8:101081743-101081765 CAGTATAGGAAGATGGTGGAAGG + Intergenic
1046064477 8:109180589-109180611 CTGGATCTGAAGGAGGTGGTGGG - Intergenic
1046711549 8:117516972-117516994 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1048937927 8:139372373-139372395 CTGGATTTGCAGATGGGGGAAGG - Intergenic
1049663858 8:143834270-143834292 CTAGCTCTGAAGATGGAGGAGGG + Exonic
1050909079 9:11043635-11043657 ACATATCTGAAGAGGGTGGACGG - Intergenic
1050962250 9:11749559-11749581 CCGACTTTGAAGATGGAGGAAGG - Intergenic
1051593805 9:18803339-18803361 CTGGTTGTGAAGATGGAGGAAGG - Intronic
1051880455 9:21834581-21834603 CTGGCTCTGAAGATGGATGAGGG - Intronic
1053294998 9:36906401-36906423 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055110115 9:72551055-72551077 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1055400988 9:75923857-75923879 CTGGCTCCGAAGATGGTAGAAGG - Intronic
1055427046 9:76207020-76207042 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1055697978 9:78908935-78908957 CTAGCTTTGAAGATGGTGGAAGG + Intergenic
1056195669 9:84226038-84226060 CCAGATCTCTAAATGGTGGAGGG - Intergenic
1057133465 9:92670324-92670346 CCGGATGTGTAGCTGGCGGAAGG + Intergenic
1057533318 9:95874658-95874680 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1058952557 9:109917156-109917178 CTGGTTTTGAAGATGGAGGAAGG + Intronic
1059462575 9:114443443-114443465 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1060112645 9:120917703-120917725 CTGGCTTTGAAGATGGAGGAAGG - Intronic
1061292493 9:129659312-129659334 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1061751785 9:132783226-132783248 CGGCCTCTGAAGATGGTGGGAGG + Intronic
1203787187 EBV:134531-134553 CTGGAGCTGAAGTTGATGGATGG + Intergenic
1186052616 X:5614938-5614960 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186421050 X:9426761-9426783 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1186584756 X:10860994-10861016 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1186624976 X:11283729-11283751 CTGGCTTTGAAGATGGAGGAAGG + Intronic
1186689977 X:11964943-11964965 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1187094446 X:16131620-16131642 CAGGATCTGTAGGTGGAGGAAGG - Intronic
1187123595 X:16432919-16432941 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1187146807 X:16644596-16644618 CTGGCTTTGAAGATGGAGGATGG + Intronic
1189182380 X:39016485-39016507 CCTGCTCAGAAGATGGTGGCAGG + Intergenic
1190517860 X:51243486-51243508 CAGGTGCTGATGATGGTGGATGG + Intergenic
1195494196 X:105510721-105510743 CTGACTTTGAAGATGGTGGAAGG + Intronic
1195521793 X:105839013-105839035 CTGGATTTGAAGTTGGTGCAGGG + Intronic
1196023567 X:111015771-111015793 CCTGATTTAAAAATGGTGGAAGG - Intronic
1197140651 X:123114215-123114237 CTGGATTTGAAGATGAGGGAAGG - Intergenic
1199424783 X:147688518-147688540 CTGGCTTTGAAGATGGAGGAAGG + Intergenic
1199691083 X:150309468-150309490 CTGGCTTTGAAGATGGAGGAAGG - Intergenic
1201578643 Y:15488065-15488087 CCAGCTTTGAAGATGGAGGAAGG - Intergenic
1201906782 Y:19093557-19093579 CAGGAGCTGGAGATGGAGGAGGG - Intergenic