ID: 986788789

View in Genome Browser
Species Human (GRCh38)
Location 5:11140616-11140638
Sequence ACATGGGAAGAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986788783_986788789 1 Left 986788783 5:11140592-11140614 CCAGTTCCTACTGTGATGTCAAA 0: 1
1: 0
2: 1
3: 13
4: 150
Right 986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG No data
986788782_986788789 10 Left 986788782 5:11140583-11140605 CCAATGCTACCAGTTCCTACTGT 0: 1
1: 0
2: 0
3: 13
4: 123
Right 986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG No data
986788784_986788789 -5 Left 986788784 5:11140598-11140620 CCTACTGTGATGTCAAACACATG 0: 1
1: 0
2: 0
3: 25
4: 324
Right 986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986788789 Original CRISPR ACATGGGAAGAGAGGGAAGA AGG Intronic
No off target data available for this crispr