ID: 986795878

View in Genome Browser
Species Human (GRCh38)
Location 5:11211380-11211402
Sequence GGACAGACTGACCATCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986795876_986795878 -8 Left 986795876 5:11211365-11211387 CCATGTGCCATGTGAGGACAGAC 0: 1
1: 1
2: 31
3: 377
4: 1202
Right 986795878 5:11211380-11211402 GGACAGACTGACCATCAGCTAGG 0: 1
1: 0
2: 0
3: 13
4: 155
986795874_986795878 14 Left 986795874 5:11211343-11211365 CCTAACTCATTGCTTTTAAAGAC 0: 1
1: 0
2: 0
3: 37
4: 356
Right 986795878 5:11211380-11211402 GGACAGACTGACCATCAGCTAGG 0: 1
1: 0
2: 0
3: 13
4: 155
986795873_986795878 15 Left 986795873 5:11211342-11211364 CCCTAACTCATTGCTTTTAAAGA 0: 1
1: 1
2: 2
3: 24
4: 301
Right 986795878 5:11211380-11211402 GGACAGACTGACCATCAGCTAGG 0: 1
1: 0
2: 0
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986795878 Original CRISPR GGACAGACTGACCATCAGCT AGG Intronic
902342644 1:15794147-15794169 GGACAGGGTGACCATCAGAAAGG - Intergenic
903554868 1:24186212-24186234 GGACAGGCTGTCCATCCACTGGG - Intronic
906125222 1:43423299-43423321 GGACAAACTGCTCATCAGGTTGG + Exonic
907093691 1:51754109-51754131 GGACAGAGTGAAGATAAGCTAGG + Intronic
907336756 1:53704689-53704711 GGACAGCCTGGCCATCAGCGGGG + Intronic
907868778 1:58424117-58424139 GAGCAAACTGGCCATCAGCTTGG - Intronic
909579163 1:77213292-77213314 GGACAGACTGACCATGTGGTAGG + Intronic
909635332 1:77811436-77811458 GGACAGGCTGAACATCAAATGGG + Intronic
920173700 1:204087259-204087281 GGCCAGGCTGCCCATCACCTGGG + Intronic
921020752 1:211233508-211233530 GGACAGACTGCCCTTCACCCAGG - Intergenic
922122618 1:222687602-222687624 GGACAGGCTGAACATCAAATGGG + Exonic
922476516 1:225910531-225910553 GGAGATGCTGACCCTCAGCTGGG - Intronic
1065873196 10:29973855-29973877 GCAAAGACTGACCCTCAGCGGGG + Intergenic
1066537693 10:36409713-36409735 GGAGAAAGTGACCAACAGCTTGG + Intergenic
1067167934 10:43880022-43880044 GGACACACTCGCCATCTGCTAGG - Intergenic
1067939010 10:50636638-50636660 GGACAAGCTTACCATCAGATAGG + Intergenic
1074402295 10:113152173-113152195 GTACATACTGACCGTCGGCTGGG - Intronic
1075077805 10:119362760-119362782 GGTCAGACTGAAGATCAGGTGGG + Intronic
1075777377 10:124997486-124997508 GCACAGTCAGGCCATCAGCTTGG - Intronic
1075933448 10:126319491-126319513 GCATAGACTGGCCCTCAGCTGGG - Intronic
1076237516 10:128876829-128876851 GGAAAGAAAGACCATCGGCTGGG - Intergenic
1077013739 11:391046-391068 GGACAGACTGACCAACAGGCCGG + Intergenic
1077911451 11:6575182-6575204 GGACAGGCTGACCACCTGTTAGG - Intronic
1077959884 11:7064355-7064377 TGACAGACTGACCCTCGGCCTGG - Intronic
1081846274 11:46242898-46242920 GGACACACAGACCCTGAGCTAGG - Intergenic
1084887486 11:72220722-72220744 GGAGAGAGGGACCATCATCTGGG + Intronic
1086146270 11:83555536-83555558 AGACAGACTGACAAACAGATAGG - Intronic
1088325383 11:108595511-108595533 GGCCAGACTGAACAAAAGCTTGG + Intergenic
1088388033 11:109281527-109281549 GGAGAGAAGGACCATCAGGTGGG + Intergenic
1091089963 11:132762296-132762318 GGACAGACTGCCCCTCAAGTGGG - Intronic
1092041637 12:5390170-5390192 GGGCAACCTGACCATCATCTGGG - Intergenic
1093374785 12:18411594-18411616 TGACACACTCAGCATCAGCTTGG - Intronic
1095176308 12:39095950-39095972 GTAGAGAAAGACCATCAGCTGGG - Intergenic
1095291341 12:40483376-40483398 GGACAACTAGACCATCAGCTGGG + Exonic
1095291353 12:40483466-40483488 GGACAACTGGACCATCAGCTGGG + Exonic
1095291373 12:40483616-40483638 GGACAACTGGACCATCAGCTGGG + Exonic
1095291736 12:40486095-40486117 GGACAACTGGACCATCAGCTAGG + Exonic
1095291866 12:40486992-40487014 GGACAGCTGGACTATCAGCTAGG + Exonic
1097861987 12:64527125-64527147 GGACAGCATGAGCTTCAGCTGGG - Intergenic
1098529265 12:71521970-71521992 AGAGAGATTGACCATCAGTTTGG - Intronic
1098963390 12:76762389-76762411 GAACAGAATGAAAATCAGCTCGG + Intergenic
1105427599 13:20307653-20307675 GCACAGACCGGCCATCAGCCAGG - Intergenic
1109197119 13:59390495-59390517 GTACAGAAAGACCATCAGGTCGG + Intergenic
1115164599 14:30434393-30434415 GGTCAAAGTGACCATCAGCAAGG + Intergenic
1117053156 14:51882677-51882699 GGACAGAATTTGCATCAGCTAGG + Intronic
1119170755 14:72534738-72534760 GCACAGACCTCCCATCAGCTGGG - Intronic
1119583639 14:75811330-75811352 GGACAGACAGATAAACAGCTTGG - Intronic
1120860078 14:89247081-89247103 GGACAGACTGACTATTGGGTGGG - Intronic
1120893825 14:89512184-89512206 GGGCAGTATGACCAGCAGCTTGG + Intronic
1122054147 14:99081124-99081146 TGACAGACTGAAGATCATCTTGG - Intergenic
1122248316 14:100420038-100420060 TTACAGACTGACCACCAGGTGGG - Intronic
1124067198 15:26355203-26355225 TCAGAGACTGACCATCACCTAGG - Intergenic
1124631237 15:31338794-31338816 GGCCAGACTGAACCTCAGCTTGG - Intronic
1126105803 15:45146354-45146376 GAACAGAGGGACCCTCAGCTGGG + Intronic
1127252541 15:57255900-57255922 AGACACACTGAACAACAGCTTGG - Intronic
1127840277 15:62825650-62825672 GACCAGCCTGACCAACAGCTGGG + Intronic
1128178283 15:65576640-65576662 AGACAGACTGAACATGAGATAGG - Exonic
1128411880 15:67407573-67407595 GGACACACAAACCAACAGCTTGG - Intronic
1130356154 15:83132358-83132380 GGACAGACTCACCATGGGCTTGG + Exonic
1130395140 15:83494870-83494892 GGACAAACTGTCAATCAGGTTGG - Intronic
1133166817 16:3953849-3953871 GGACAAAGTGACCATCAGCACGG + Intronic
1134321754 16:13170546-13170568 GCACAGACCAACCATCACCTAGG - Intronic
1138486137 16:57345227-57345249 GGAGAGAATGACTATAAGCTGGG + Intergenic
1139758435 16:69164177-69164199 GTAAAAACTGACCATCAGCCGGG - Intronic
1140259257 16:73363131-73363153 GGACTGGCTGACCATCAGCCTGG - Intergenic
1141670096 16:85487100-85487122 GGACAGAGAGCCCATCCGCTGGG - Intergenic
1142101973 16:88277060-88277082 GTACAGACTGAGCATCAGTGTGG - Intergenic
1142913767 17:3116904-3116926 GGACAGCCTGGCCATAAGCAAGG - Intergenic
1144158913 17:12537656-12537678 GGATAGCCTGACCAACACCTTGG + Intergenic
1147451797 17:40510307-40510329 GGACAGACGGTCCAGCAGCTTGG - Intergenic
1149577527 17:57724841-57724863 AGACAGACTGTCCTTGAGCTCGG + Intergenic
1149713370 17:58763232-58763254 GGACAGAGTCTCCATCAGCCTGG - Intronic
1149909542 17:60554365-60554387 GGACAGACTTATAAACAGCTGGG + Intergenic
1150229697 17:63543358-63543380 GGCCAGAATGCCCAGCAGCTGGG + Intronic
1151745637 17:76010286-76010308 GGACAGGCTGCCCTCCAGCTGGG + Exonic
1152417682 17:80173351-80173373 GGACAGACTGATCGGCAGATTGG + Intronic
1154939804 18:21100496-21100518 GGACAAACTGAGTATCAGCAAGG + Intronic
1156381887 18:36569527-36569549 TGACAGACTGAAAATCAGCAAGG + Intronic
1157330490 18:46700536-46700558 GGACCTGCTGACCCTCAGCTTGG + Intronic
1160887748 19:1359364-1359386 GGCCGGGCTGACCATCATCTTGG + Intronic
1161243010 19:3233376-3233398 GGAGAGACTGACGATAAACTAGG + Intronic
1163683921 19:18699975-18699997 TGACAGACTGAGCCTCATCTCGG + Intronic
1163795333 19:19334653-19334675 GGGCATTCTGACCCTCAGCTAGG + Intronic
1164849531 19:31470135-31470157 GGACTGACTGTCAATCAACTGGG - Intergenic
1165936808 19:39394285-39394307 GGACAGTCTCACCATCACCCAGG + Intronic
1166086832 19:40481769-40481791 AAAAAGACTGACCATCAGCTGGG - Intronic
1168076720 19:53984382-53984404 GGACAGAGTGACCAACTGCCAGG + Exonic
926956619 2:18308836-18308858 GTACAGACTGACCATCAATTAGG + Intronic
929489654 2:42384950-42384972 GGACACACAGGCCATCAGCTGGG + Intronic
932268887 2:70391607-70391629 GGACACAGTGACCTTCAGTTTGG + Intergenic
934738999 2:96705584-96705606 GGACAAACTGACCTAGAGCTTGG - Intergenic
942207069 2:173629777-173629799 GCACAGGGTGACCATCATCTTGG + Intergenic
942229172 2:173843693-173843715 GAAGAGTCTTACCATCAGCTCGG - Intergenic
947336629 2:229092523-229092545 GGACATACTGCCTTTCAGCTTGG - Intronic
947460518 2:230299998-230300020 GTAGAGAAAGACCATCAGCTGGG - Intronic
948476806 2:238225875-238225897 GGACAGACAGACCAGGAGTTGGG - Intronic
948619868 2:239227572-239227594 GGACAGACAGACAAGCACCTTGG + Intronic
1169037559 20:2466022-2466044 GGACACACTGACCAAGAGATAGG + Intronic
1171456983 20:25277691-25277713 GGACAGACAGATCACCTGCTTGG - Intronic
1173728715 20:45314030-45314052 GGGCAGAGTGCCCATCAGCTGGG - Exonic
1179382396 21:40911488-40911510 GCACAGAGTGCCCAGCAGCTAGG + Intergenic
1179732119 21:43373814-43373836 GGACCCACTGACCGTCTGCTGGG + Intergenic
1180088076 21:45517023-45517045 GGACAGACTGACCAGGCCCTCGG + Intronic
1181410193 22:22713116-22713138 GGCCACCCTGACCATCAGCAGGG + Intergenic
1181427061 22:22850573-22850595 GGCCACCCTGACCATCAGCAGGG + Intronic
1184179896 22:42813746-42813768 GGACCGACAGACCACCAGCCAGG + Intronic
1184693617 22:46128314-46128336 GGCCAGACTGCCCCCCAGCTGGG + Intergenic
951609920 3:24480207-24480229 CAAAAGACTGACCATCAGTTTGG - Intronic
952062384 3:29526104-29526126 GGACAGCCTGGGCATCATCTGGG + Intronic
952817026 3:37454417-37454439 AGACAGTCTGGCCTTCAGCTTGG + Intronic
957849022 3:85780996-85781018 GGATAGGCTGGCCGTCAGCTGGG - Intronic
961474348 3:127137404-127137426 GCACAGGCTGGCTATCAGCTAGG - Intergenic
962847441 3:139284437-139284459 GGACAGTCTGACAGGCAGCTGGG + Intronic
968323900 3:197795349-197795371 ATACTGACTGACCATTAGCTAGG - Intronic
969167765 4:5331421-5331443 GGACAGAGGGACCATGGGCTAGG + Intronic
969306897 4:6330933-6330955 GAACACAGTGACCCTCAGCTTGG - Intronic
983520363 4:168702253-168702275 AGAAAAACAGACCATCAGCTGGG + Intronic
986683510 5:10254770-10254792 GGACAGTTCCACCATCAGCTTGG - Exonic
986795878 5:11211380-11211402 GGACAGACTGACCATCAGCTAGG + Intronic
987521034 5:18983938-18983960 AGTCAGACAGACCATTAGCTGGG + Intergenic
987563592 5:19555660-19555682 GTACAGAAAGACCATCAGATGGG - Intronic
988002248 5:25363282-25363304 GTACAGAAAGACCATCAGATGGG - Intergenic
990657571 5:57974185-57974207 GGACAGACTGGTCATCAGAATGG - Intergenic
995217841 5:109615423-109615445 GGACAGTCAGACCATCAGTCAGG - Intergenic
1001354285 5:171004745-171004767 GGACAGTCTGACCTCCAGCGGGG + Intronic
1001669675 5:173463349-173463371 AGGCAGATTGACCTTCAGCTTGG + Intergenic
1002181030 5:177431270-177431292 GGACAGAGGGAGCAGCAGCTGGG + Intronic
1002673592 5:180890353-180890375 GGACAGACTGCCCTTCAACTGGG + Intergenic
1006193534 6:32223536-32223558 GAACACACTGACCACCTGCTTGG - Intronic
1006381825 6:33703094-33703116 GGACAAGCTGACCAGCAGCAGGG - Intronic
1007230413 6:40344118-40344140 GCAGGGACAGACCATCAGCTGGG - Intergenic
1007628019 6:43257441-43257463 GCACAGACTGCCCCTCTGCTGGG - Intronic
1008959828 6:57255071-57255093 AGGCAGCCTGACCCTCAGCTTGG + Intergenic
1011623614 6:89265665-89265687 GGACAGCATGACCATCAGAGTGG + Exonic
1012920168 6:105213632-105213654 GGTCAGACTGACCATGATTTTGG - Intergenic
1014142579 6:117961414-117961436 AGACTGCCTGAGCATCAGCTGGG - Intronic
1015112205 6:129605867-129605889 GGACACACTGAAGGTCAGCTTGG - Exonic
1018036965 6:159889845-159889867 GGGAAGCCTGACCAGCAGCTCGG - Intergenic
1018625307 6:165771998-165772020 GAAAAGACTGACCTTCAGGTGGG - Intronic
1019704873 7:2492794-2492816 GGACAGACAGACAGACAGCTAGG - Intergenic
1020743768 7:12055392-12055414 GCACAGACAGGTCATCAGCTAGG - Intergenic
1029604434 7:101590205-101590227 GGACACACAGGGCATCAGCTGGG - Intergenic
1032636441 7:133714180-133714202 GGACAGGCTGACCATGGACTAGG + Intronic
1033015661 7:137668753-137668775 GGAGAGCCTGACTGTCAGCTAGG + Intronic
1033137906 7:138799945-138799967 GGACACACTGACCCACAGCCAGG + Intronic
1034100523 7:148446171-148446193 GGGCGGCCTGACCATGAGCTGGG + Intergenic
1035301928 7:157902903-157902925 GGAGAGGCTCACAATCAGCTTGG - Intronic
1038426055 8:27464665-27464687 GGACCGACTCATCATCTGCTAGG - Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1047932861 8:129748476-129748498 GGACTGACTGCCCATCAGGGAGG + Exonic
1049183591 8:141236613-141236635 TGACAAAATGACCATCATCTGGG + Intronic
1049328048 8:142034286-142034308 AGAGAGACTGGCCATCAGCAGGG + Intergenic
1051876109 9:21795448-21795470 GGAAGGAGTGACCATCAGCCTGG - Intergenic
1052287317 9:26800961-26800983 TGAAAGACTGACAAACAGCTTGG - Intergenic
1053140560 9:35680129-35680151 GGGCAGACTCACCAGCAGCCAGG - Exonic
1056527541 9:87457236-87457258 GGACAGGCTGAGCTTCAGTTTGG + Intergenic
1059489845 9:114657946-114657968 GGAAAGACTGACCCTCAGAGTGG - Intergenic
1060829342 9:126704016-126704038 GTACAGATTGACAATCAGCCTGG + Intergenic
1061017597 9:127991010-127991032 GGGCAGCCTGACCATGTGCTAGG + Intergenic
1061055105 9:128218362-128218384 GGCCAGGCTGGCCCTCAGCTTGG - Intronic
1061783781 9:133011760-133011782 AACCAGACTGACCATCTGCTGGG + Intergenic
1062358305 9:136175469-136175491 GGACAGACCCTCCCTCAGCTGGG + Intergenic
1189225137 X:39406581-39406603 GCACAGACTGCCCATCAGAGAGG - Intergenic
1189751946 X:44231360-44231382 GCACAGACTGCCCATCAGAGAGG - Intronic
1194141024 X:90209814-90209836 AGACAGACTGCCCCTCGGCTGGG + Intergenic
1196157695 X:112449123-112449145 GGCCAAATTGACCCTCAGCTGGG + Intergenic
1198801449 X:140452036-140452058 TGTCAGAGTGACCATCAGGTTGG - Intergenic
1199449948 X:147968082-147968104 GGACAGACTGCCCCTCAAGTGGG + Intergenic
1200486789 Y:3778932-3778954 AGACAGACTGCCCCTCGGCTGGG + Intergenic