ID: 986802329

View in Genome Browser
Species Human (GRCh38)
Location 5:11275013-11275035
Sequence TAGAGTTGGTAGGAAGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986802323_986802329 4 Left 986802323 5:11274986-11275008 CCAATGTTACTAACATAATTACG 0: 1
1: 0
2: 1
3: 4
4: 74
Right 986802329 5:11275013-11275035 TAGAGTTGGTAGGAAGCTGGAGG No data
986802322_986802329 18 Left 986802322 5:11274972-11274994 CCTAGGGTGTTTCACCAATGTTA 0: 1
1: 0
2: 0
3: 20
4: 167
Right 986802329 5:11275013-11275035 TAGAGTTGGTAGGAAGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986802329 Original CRISPR TAGAGTTGGTAGGAAGCTGG AGG Intronic
No off target data available for this crispr