ID: 986802499

View in Genome Browser
Species Human (GRCh38)
Location 5:11276706-11276728
Sequence GAGGAAATCATCCTGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 2, 2: 34, 3: 135, 4: 483}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986802495_986802499 29 Left 986802495 5:11276654-11276676 CCTTATTTGAAAGCAGTGCGTTT 0: 1
1: 0
2: 2
3: 17
4: 212
Right 986802499 5:11276706-11276728 GAGGAAATCATCCTGGATTCAGG 0: 1
1: 2
2: 34
3: 135
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986802499 Original CRISPR GAGGAAATCATCCTGGATTC AGG Intronic
900478172 1:2885862-2885884 GATGAAATCGGCCTGGATTTAGG - Intergenic
900999490 1:6141646-6141668 GATGAGATCATACTGGATTAGGG + Intronic
901087498 1:6620316-6620338 GAGGACATCATGGTGGACTCAGG + Exonic
901827943 1:11874745-11874767 GATGAGATCATACTGGATTAGGG + Intergenic
902040112 1:13486320-13486342 GATGAGATCATCCTGGACTGAGG - Intronic
902237692 1:15068287-15068309 GAGGAAAGCTGGCTGGATTCGGG + Intronic
902643484 1:17781580-17781602 GATGAAATCCTCCTGGATTTAGG - Intronic
902963180 1:19978911-19978933 GAGGAAGTCACCCTGGACTTAGG - Intronic
904727625 1:32561755-32561777 GATGAGGTCATCCTGGATTAGGG - Intronic
905097249 1:35484042-35484064 GGTGAAATCATCCTGTATTTAGG - Intronic
906071086 1:43016929-43016951 GATAAGATCATCCTGGATTTAGG + Intergenic
906603188 1:47147035-47147057 GTGGAAATCATCGTGGCATCAGG + Intronic
907051872 1:51335062-51335084 GAGGAAGGCATCCAGGACTCAGG - Intronic
907222514 1:52917312-52917334 GAGCAAATCCTCCTTGTTTCCGG - Intronic
907522961 1:55037177-55037199 GAGGAGATTATCCTGGGTTTAGG - Intergenic
907921057 1:58911992-58912014 ATGGAAATCTTCCTGGACTCAGG - Intergenic
908351242 1:63287358-63287380 GATGGAATGATCCTGGATTCTGG - Intergenic
908358079 1:63341762-63341784 GTGGAAATCAGCCTGGATTAGGG - Intergenic
911058449 1:93727881-93727903 GATGAGAACATCCTGGATTTGGG + Intronic
911445180 1:97983813-97983835 GAGGAAATCAGCCAGGAATAAGG + Intergenic
911748513 1:101468148-101468170 GATGAAATCATCCTGGATTTGGG - Intergenic
912138875 1:106696868-106696890 AATGAGATCATCCTGAATTCAGG + Intergenic
912749200 1:112271605-112271627 TATGAAATCATCCTGGATTTAGG - Intergenic
912946686 1:114090750-114090772 GAGCAAATCAACCTGGTTTTAGG + Exonic
913674517 1:121128570-121128592 GATGAAATCATGCTGGATATAGG + Intergenic
914026300 1:143915879-143915901 GATGAAATCATGCTGGATATAGG + Intergenic
914314735 1:146499422-146499444 AAGGAAATCACACTGGATACAGG + Intergenic
914499616 1:148233966-148233988 AAGGAAATCACACTGGATACAGG - Intergenic
914664737 1:149823632-149823654 GATGAAATCATGCTGGATATAGG + Intergenic
914671028 1:149870186-149870208 GATGAAATCATGCTGGATATAGG - Intronic
915582994 1:156826656-156826678 TAGAAAAACATCCTGGATTCTGG - Intronic
916447328 1:164885371-164885393 GAGGAAAAATGCCTGGATTCTGG + Intronic
916553964 1:165876946-165876968 GATGAGATCATCCTGAATTAGGG - Intronic
916657782 1:166892695-166892717 GATGAGATCATCCTGGATTTTGG + Intergenic
917155995 1:171999704-171999726 GATGAGATAATCCTGGATTTAGG + Intronic
917615819 1:176743137-176743159 GAGGAAATCCTCACAGATTCTGG - Intronic
918015154 1:180625990-180626012 GATGAAGTCATACTGGATTAAGG + Intergenic
918232777 1:182550957-182550979 GAGGAAAGCATCCTGGCCTTGGG - Intronic
918406759 1:184219104-184219126 GAGGAAATCATTCTGGCTTTTGG - Intergenic
918493566 1:185109345-185109367 GATGAAATCATCCTGGATTAAGG - Intergenic
918537821 1:185593915-185593937 GTGGAAATCAGGCTGGATCCAGG + Intergenic
919508290 1:198428014-198428036 GAGGATATCATCCTGGATTAGGG + Intergenic
920107890 1:203567316-203567338 GAATAAATCATCCTGGATTTAGG + Intergenic
921079954 1:211731203-211731225 GAGGGAATCATCCTTGTTTTAGG + Intergenic
921176977 1:212604304-212604326 CAGGACTTCATCTTGGATTCTGG + Intronic
921470954 1:215548655-215548677 GAAGAGATCATCCTGGATTTAGG + Intergenic
921780339 1:219155506-219155528 GTGTAAATCACCCTGGATTTAGG + Intergenic
922060121 1:222081123-222081145 GATGGTATCATCCTGGATTTAGG - Intergenic
922332137 1:224586731-224586753 GATAAAATCATCCTGGATTCAGG + Intronic
923151482 1:231237448-231237470 AAGGAGATCATCCCAGATTCAGG + Intronic
923221934 1:231903272-231903294 GAGGAGGTCATACTGGATTAGGG - Intronic
923993882 1:239470088-239470110 GATGAGATCATCCTGGATTTAGG + Intronic
1063102461 10:2962625-2962647 GACGAGATCATCCTGGATTAGGG - Intergenic
1063444872 10:6106067-6106089 GAGGAAGTCATCCCAGGTTCAGG + Intronic
1064292078 10:14044442-14044464 CATGAGATCATCCTGGATTAGGG + Intronic
1064923886 10:20549271-20549293 GATGAGAACATCCTGGATTGAGG + Intergenic
1065001724 10:21343339-21343361 GATGAGATCATCCTGGGTTACGG - Intergenic
1066033612 10:31456075-31456097 GAGGAACTCATCCTGTTTTAGGG - Intronic
1067253269 10:44608081-44608103 TAGGAAATTATCCTGGATTATGG + Intergenic
1067448520 10:46367452-46367474 GGGCAAAGCATCCTGGACTCTGG + Intergenic
1067588854 10:47493313-47493335 GGGCAAAGCATCCTGGACTCTGG - Intergenic
1067635980 10:48001404-48001426 GGGCAAAGCATCCTGGACTCTGG - Intergenic
1067877507 10:50018923-50018945 GGGCAAAACATCCTGGACTCTGG + Intergenic
1068739316 10:60450988-60451010 GAAGAGATTATCCTGGATTAGGG + Intronic
1069579588 10:69556461-69556483 GATGAGATCGTCCTGGATTAGGG - Intergenic
1069955569 10:72049132-72049154 GATAAAATCATACTGGATTTGGG + Intergenic
1070132544 10:73665412-73665434 GGGCAAAACATCCTGGACTCTGG - Intergenic
1070720827 10:78755833-78755855 TAGAAAACCATGCTGGATTCTGG + Intergenic
1070858313 10:79627946-79627968 GAGCAAAGAAACCTGGATTCTGG - Intergenic
1071876544 10:89849284-89849306 GATGAGATCATCCTGGATTTAGG + Intergenic
1072481826 10:95816486-95816508 GATGAAATCATCTTGAATTTAGG + Intronic
1072538961 10:96384063-96384085 GATGAAATCATCTTGGATTTAGG + Intronic
1072550689 10:96475004-96475026 GATGAGATCCTCCTGGATTTAGG - Intronic
1074181430 10:111068353-111068375 GATGAAATCATCCTGGATTTAGG + Intergenic
1074337509 10:112593064-112593086 GAGGAGATCATCCTCGCTTTTGG - Intronic
1074358641 10:112807531-112807553 GAGGAAATCATTCCAGATTTAGG - Intronic
1074558870 10:114517212-114517234 GAGAAGGCCATCCTGGATTCAGG + Intronic
1074713436 10:116197070-116197092 GAGGAAATCATCCAGGATTTAGG - Intronic
1074766160 10:116701605-116701627 GAGGAAAGAATGCAGGATTCGGG + Intronic
1074876577 10:117618261-117618283 GCTGAAATCATTCTGGATTAAGG + Intergenic
1074910318 10:117902669-117902691 GAGGAGATCATCCTGGATTTGGG - Intergenic
1075214786 10:120522947-120522969 GATGAGATCATTCTGGATTTAGG + Intronic
1075953830 10:126505410-126505432 GAGGATATGAGCCTGTATTCAGG - Intronic
1076040942 10:127247929-127247951 GCCGAAATCATCCCAGATTCTGG - Intronic
1076175258 10:128363279-128363301 GATGAGATCATACTGGATTAAGG + Intergenic
1076208020 10:128618746-128618768 GAAGAAATCAACCTGGACTTAGG - Intergenic
1076707899 10:132311787-132311809 GATGATATCATCCTGGAGTAGGG - Intronic
1078108089 11:8371212-8371234 GATGAAATCATCCTAGATTTAGG + Intergenic
1078879125 11:15430752-15430774 GAAGAAAGCATCCTTGATTTAGG - Intergenic
1079813108 11:25020957-25020979 GATGAAAAGTTCCTGGATTCTGG + Intronic
1079849912 11:25519020-25519042 GAGGAAATAAGCATGGATTTTGG - Intergenic
1080045670 11:27805260-27805282 CATGAGATCATCCTGGATTTAGG + Intergenic
1080247734 11:30198505-30198527 GATGAAGTCATCCTGGATTAGGG - Intergenic
1080569271 11:33541830-33541852 GAGGAAATGACTCTGGAGTCCGG - Intergenic
1080931444 11:36815696-36815718 GATTAAATCATCCTGGATTTAGG + Intergenic
1081491197 11:43570335-43570357 GATGATTTCATCCTGTATTCAGG - Intronic
1083092093 11:60210368-60210390 CAGGAATTCATCATGGACTCTGG + Intronic
1083100856 11:60304445-60304467 CAGGAATTCATCATGGACTCTGG - Intronic
1083598188 11:63929884-63929906 GATGAGATCATCCTGGATTTAGG - Intergenic
1084246634 11:67862155-67862177 GATGAAGTCATCCTGGAGTAAGG + Intergenic
1084484451 11:69439633-69439655 GATGAGATCATCCTGGACTAGGG + Intergenic
1084618112 11:70250082-70250104 GATGAAAGCATCCTGGATTTAGG - Intergenic
1084718478 11:70889148-70889170 GATGAGATCATCCTGGATTTAGG + Intronic
1085077608 11:73605635-73605657 GATGAGATCCTCCTGGATTTAGG + Intergenic
1085649519 11:78255048-78255070 GAGGAAGTCATACTGGATTAGGG + Intronic
1087474139 11:98616568-98616590 GGGGAAATCATCTTAGATTTAGG - Intergenic
1088271105 11:108035382-108035404 TATGAAAACATCATGGATTCTGG - Intronic
1088576359 11:111275560-111275582 GAGGAAAGCAGCCTCAATTCAGG + Intronic
1088963736 11:114697198-114697220 GATGAGATCATCCTGGATTAAGG + Intronic
1089908125 11:122066388-122066410 GAGGATATCGTCCTGGATAAGGG - Intergenic
1090501023 11:127261391-127261413 GACGAGATCATTCTGGATTTAGG - Intergenic
1090704514 11:129324459-129324481 GGGGAAAACAGCCTTGATTCTGG - Intergenic
1091384895 12:87296-87318 GAGGAAATCAGCCTTCATGCTGG - Intronic
1091891540 12:4058850-4058872 TATGAAATCATCCTGGATTTAGG - Intergenic
1092041815 12:5391777-5391799 GATGACATAATCCTGGATTTAGG - Intergenic
1092080515 12:5712334-5712356 GATGAGATCATCATGGATTTAGG + Intronic
1092417201 12:8299402-8299424 GATGAAGTCATCCTGGAGTAGGG + Intergenic
1092701031 12:11231205-11231227 GATAAAAGTATCCTGGATTCAGG + Intergenic
1093002371 12:14011721-14011743 AAAGAGATCATCCTGGATTAGGG + Intergenic
1093896425 12:24579783-24579805 GAGGAAGTCATACTGGATTTGGG + Intergenic
1094345035 12:29458557-29458579 GAGGAAACTTTCCAGGATTCTGG + Intronic
1094438833 12:30452524-30452546 GAAGAAGTCATCCTGGATTAGGG + Intergenic
1095403927 12:41846330-41846352 GAGGAGATAATCCTGGATTAGGG - Intergenic
1095508539 12:42924561-42924583 GATGAGATCATCCTGGATTTAGG + Intergenic
1095508811 12:42927137-42927159 CATGAAATCATCCTGCATTCAGG - Intergenic
1095669569 12:44842731-44842753 GATGAGATCATACTGGATTAGGG + Intronic
1095872476 12:47045215-47045237 GATGAAATCATCCTGGATTTAGG - Intergenic
1096871413 12:54594828-54594850 GATGAAATAATACTGGATTTGGG - Intergenic
1097987347 12:65797923-65797945 GATGAGATCATCCTGGATGCAGG + Intergenic
1098378212 12:69840374-69840396 GAGGAAATTATGCTAGAATCAGG - Intronic
1099078716 12:78146911-78146933 GAGCAAATCAAACTGCATTCAGG + Intronic
1099430158 12:82573623-82573645 GATGAGATCACCCTGGATTTAGG - Intergenic
1099690145 12:85941665-85941687 GATGAAGTCATCCTGGATTTAGG - Intergenic
1100003867 12:89870683-89870705 AAGGAAATCATATTGGAATCAGG - Intergenic
1100397650 12:94198838-94198860 GATGAAATCATCCTGGATTTAGG - Intronic
1100523383 12:95398085-95398107 GATGAAATCATCCTGGATTTAGG + Intergenic
1100907010 12:99313208-99313230 TACGATATCATCCTGGTTTCTGG - Intronic
1101285407 12:103306813-103306835 GATGAAATCATTCTGGATTAGGG + Intronic
1101571123 12:105954730-105954752 GTTGAAATCATCCTGAATTTAGG - Intergenic
1101953541 12:109194726-109194748 GATGAAATCATACTGGATTAGGG - Intronic
1102148274 12:110670840-110670862 GATGAAATCATACTGGATTTAGG + Intronic
1102231571 12:111266130-111266152 GATGAGATCATCCTGGCTTTAGG + Intronic
1102514320 12:113436195-113436217 GGTGAAATCATACTGGATTAGGG - Intronic
1102713728 12:114952070-114952092 GAAGAAATCTCCCTGCATTCGGG - Intergenic
1103021848 12:117540551-117540573 GATGAGATCATCGTGGATTCGGG + Intronic
1103021855 12:117540619-117540641 ATCCAAATCATCCTGGATTCGGG + Intronic
1103141435 12:118552172-118552194 GATGAGATCATACTGGATTTAGG - Intergenic
1103469863 12:121171523-121171545 GATGAGATTATCCTGGATTTAGG - Intronic
1103681606 12:122698818-122698840 GATGAGAGCATCCTGGATTAGGG + Intergenic
1103683358 12:122712256-122712278 GATGAGAGCATCCTGGATTAGGG + Intergenic
1103737039 12:123067093-123067115 GATGAAATCATACTGGATTGAGG + Intronic
1104077736 12:125405362-125405384 GATGAGACCATCCTGGATTTAGG - Intronic
1104220978 12:126784976-126784998 GATGAAATTATCCTGGCTTTAGG + Intergenic
1104351377 12:128047003-128047025 GAGAAAGTCATACTGGATTAGGG - Intergenic
1104381566 12:128312245-128312267 GATGAAATCATACTGGATTAGGG + Intronic
1104389014 12:128375594-128375616 GATGAAATCATCTTGGATTTAGG - Intronic
1104496074 12:129240568-129240590 GAAGAAATCATTCTGCATGCTGG - Intronic
1104620421 12:130307787-130307809 GCTGAAATCATCCTGAATTCAGG - Intergenic
1104749963 12:131231999-131232021 GGGGACAGCAACCTGGATTCCGG + Intergenic
1104780873 12:131419457-131419479 GAAGAGATCATCCTGGATTAAGG - Intergenic
1104894795 12:132158864-132158886 GCTGAGATCATCCTGCATTCAGG + Intergenic
1104915458 12:132262141-132262163 GATGAAATCCTCCTGGATTTGGG + Intronic
1104916261 12:132266413-132266435 AAAGAGATCATCCTGGATTTAGG + Intronic
1104925025 12:132309490-132309512 GATGAGGTCATCCTGGACTCGGG + Intronic
1105645228 13:22311178-22311200 GATGAGATCATTCTGGATTAGGG + Intergenic
1106433653 13:29705546-29705568 GATGAAATCATCCTGGATTTAGG + Intergenic
1107307986 13:39043560-39043582 CATGAGATCATCCTGGATTTAGG - Intronic
1107778631 13:43875450-43875472 GATGAGATCATCCTGGATTTAGG + Intronic
1107998400 13:45884229-45884251 GATGAGGTCATCCTGGATTAGGG - Intergenic
1108866519 13:54930453-54930475 GATGAAATCATGCTGAATTAGGG + Intergenic
1109240846 13:59885735-59885757 GATGAAATCATCCTGGATTTAGG + Intronic
1109679933 13:65738064-65738086 GAGGAAATACTCCAGGATACTGG + Intergenic
1109897801 13:68716401-68716423 GATGAAATCATCCTGGATTTAGG + Intergenic
1110189907 13:72718278-72718300 GATGAGGTCATCCTGGATTAGGG - Intronic
1110355215 13:74559598-74559620 AATGAAATGATCCTGGATTTAGG + Intergenic
1111083222 13:83339889-83339911 GATGATATCATACTGGATTAGGG + Intergenic
1111575594 13:90150438-90150460 GATGAAATCATCCTGGATTTGGG - Intergenic
1111697875 13:91648160-91648182 AAGGGAAGCATCCTGGAATCAGG - Intronic
1111709584 13:91794466-91794488 GAGGAAAGCTTCCTGGAAGCTGG - Intronic
1112332855 13:98490040-98490062 GAGGACACCATCTTGGCTTCTGG - Intronic
1112366200 13:98757424-98757446 GATGAACTCATCCTGGACTAGGG - Intergenic
1113112402 13:106837939-106837961 GATGAGATCATCCTAGATTTAGG + Intergenic
1113349679 13:109516856-109516878 GAGAAAATCATCCTGAATCTTGG - Intergenic
1113615200 13:111675538-111675560 GAGGAGGTCATCCAGGAGTCGGG - Intergenic
1113620667 13:111760451-111760473 GAGGAGGTCATCCAGGAGTCGGG - Intergenic
1114778340 14:25512049-25512071 GATGAGATCATCCTGAAATCAGG + Intergenic
1114874306 14:26696700-26696722 GAGGAAATTAGACTGGATTAAGG + Intergenic
1115706208 14:36001040-36001062 ACAGAAGTCATCCTGGATTCAGG + Intergenic
1117757111 14:58986846-58986868 GACGAGATCATCCTGTATTAAGG - Intergenic
1117864555 14:60132314-60132336 GATGAGATCATCCTGGATTTAGG - Intronic
1118737325 14:68711369-68711391 AAGGAAAACATCCTTGGTTCTGG - Intronic
1119128443 14:72150123-72150145 GATGAAATCATCCTGGATTTAGG + Intronic
1120236929 14:81903290-81903312 AAAGGAATCATCCTGGATCCTGG + Intergenic
1120408988 14:84127149-84127171 GATGTAATCATCCTGGAGGCTGG - Intergenic
1121529618 14:94643362-94643384 GGGGAAAGCACCCTGGATGCTGG - Intergenic
1121798296 14:96753680-96753702 GATGAGATCATCCTGGATCTAGG - Intergenic
1121833473 14:97071775-97071797 GATAAAATAATCCTGGATTTAGG + Intergenic
1122126433 14:99581058-99581080 GAGGAGACCATCCTGGAGGCAGG + Intronic
1122483056 14:102060192-102060214 GATGAGATCATCCTGGATTTAGG + Intergenic
1122602444 14:102928441-102928463 GGGGAACTCGTCCTGGCTTCAGG + Exonic
1125281521 15:38046927-38046949 CTGGAAAACATCCTGAATTCTGG + Intergenic
1126372785 15:47964766-47964788 GATGAAATCATACTGAATTAGGG - Intergenic
1126479887 15:49106357-49106379 GATGAAAGCATCCTGGTTTTAGG - Intronic
1127362268 15:58254682-58254704 AATGAGATCATCCTGGATTTAGG - Intronic
1127633767 15:60850154-60850176 GAGGGCATCAGCCTGGATTCAGG - Intronic
1129803080 15:78431279-78431301 GACGAAATCATACTGGAGTAAGG - Intergenic
1130141006 15:81226288-81226310 AAGGAAAACATTCTGAATTCTGG - Intronic
1130853930 15:87824191-87824213 AATGAAATCATACTGGATTGGGG + Intergenic
1131505901 15:93018848-93018870 GATGACATCATCCTGAATTTAGG - Intronic
1131537695 15:93251557-93251579 GATGAGGTCATCCTGGATTAGGG + Intergenic
1131553266 15:93375943-93375965 GATGAAGTCCTCCTGGATTTAGG + Intergenic
1132224100 15:100127254-100127276 GATGAGACCATCCTGGATTTGGG + Intronic
1132983292 16:2750256-2750278 GATGAAATCATCATGAATTTAGG - Intergenic
1133037613 16:3042950-3042972 GATGAGATCATCCTAGATTTAGG - Intergenic
1133061276 16:3175896-3175918 CAGGAAACCATCCTGGAGTGGGG + Intergenic
1133198894 16:4190320-4190342 CAGGAAGTCATCCTGGACCCAGG - Exonic
1133278008 16:4649610-4649632 GAGGAGGTCATACTGGATTGAGG - Intronic
1133557655 16:6920804-6920826 GATGGAATCATCCTGGATTCAGG - Intronic
1133736245 16:8617952-8617974 CTTGAAATCATCCTGGATTTAGG - Intergenic
1133884186 16:9810489-9810511 GATAAAGTCATCCTGGATTTAGG + Intronic
1133976665 16:10604006-10604028 GAAGAAGTCATACTGGATTAAGG + Intergenic
1133980750 16:10631609-10631631 GATGAGATCATCCTGGATTTAGG + Intronic
1134077525 16:11302360-11302382 GATGAGATCATTCTGGATTAGGG - Intronic
1134128365 16:11631778-11631800 GATGAGATCATCCTGGATTTAGG - Intronic
1134304886 16:13022939-13022961 GATGACATCATCCTGGATTATGG - Intronic
1135162715 16:20111664-20111686 GAGCAAATCATATTGGATTAGGG + Intergenic
1135502706 16:23011096-23011118 GAAGAAAAAATACTGGATTCAGG + Intergenic
1135919741 16:26638870-26638892 CATGAGATCATCCTGGATTATGG + Intergenic
1137797866 16:51237427-51237449 GAGGGAATCTTGCTGGATCCTGG + Intergenic
1138124114 16:54424672-54424694 GAGGAAACCAGCCTGTATTGAGG - Intergenic
1138402923 16:56762952-56762974 GAAGAGATTATCCTGGATTTAGG - Intronic
1139947873 16:70654116-70654138 GATCGAATCATCCTGGATTCTGG - Intronic
1140282486 16:73567193-73567215 GATGAAATCATCCTGGATTTAGG - Intergenic
1140522858 16:75597201-75597223 GATGAAATCAGACTGGATTAGGG + Intronic
1140565906 16:76042412-76042434 CAGGAACTCATCCTGCACTCAGG - Intergenic
1140908812 16:79432696-79432718 GAGGACATCATATTGGATTAGGG - Intergenic
1141002768 16:80323848-80323870 GAGGAGATGATGCTGGATTAGGG - Intergenic
1141015348 16:80443955-80443977 GATGAGATCATCTTGGATTTGGG + Intergenic
1141019296 16:80479919-80479941 TATGAAATCATTCTGGATTTAGG + Intergenic
1141064277 16:80901352-80901374 GATGAGGTCATACTGGATTCTGG + Intergenic
1141183682 16:81772127-81772149 GATGAGAACATCCTGGATTCAGG + Intronic
1141512773 16:84523513-84523535 GATGAGATCATCCTAGATTAGGG - Intronic
1141588205 16:85049244-85049266 GGGCAAATCCTCCTGGATCCAGG - Intronic
1141595308 16:85093575-85093597 GAGCAAATCATCTAGGATTAAGG - Exonic
1141716424 16:85729651-85729673 GATGAGCTCATCCTGGATTTGGG + Intronic
1141762094 16:86035347-86035369 GATGAAATCATCCTGCATCTAGG + Intergenic
1141897872 16:86970169-86970191 GATGAGATCATACTGGATTAGGG + Intergenic
1142861683 17:2766021-2766043 GAGAAGATCATCCTGGCTGCTGG - Intergenic
1144121386 17:12157256-12157278 AAGGTAATCATCCTGAATCCAGG + Intergenic
1144336043 17:14269798-14269820 GATGAGATCATCCTGGATTAGGG - Intergenic
1144794593 17:17882529-17882551 GAGGAAGTCATGATGGATTGTGG - Intronic
1145188366 17:20816330-20816352 AAGAAAACCATCCTGGAATCTGG + Intergenic
1145207120 17:20990496-20990518 AATGAGATCATCCTGGATTAGGG - Intergenic
1146179710 17:30689798-30689820 AATGAGATCATCCTGGATTAGGG - Intergenic
1146478397 17:33181671-33181693 CATGAGATCATCCTGGATTGAGG - Intronic
1146924813 17:36736786-36736808 GATGACATCATCCTGAATTCAGG + Intergenic
1149294934 17:55253515-55253537 GATGAAATCATCTTGTATTTAGG + Intergenic
1149558790 17:57593569-57593591 GAAGAGATTATCCTGGATTTAGG - Intronic
1150422388 17:65049776-65049798 GAGGATCTGATTCTGGATTCTGG - Intronic
1150593652 17:66584801-66584823 GATAAGATCATCCTGGATTTAGG - Intronic
1150596832 17:66613756-66613778 GATGAAGTCATACTGGATTAAGG - Intronic
1150713534 17:67551611-67551633 GATGAAATCATCCTGGATTTAGG - Intronic
1150721498 17:67617849-67617871 GATGAAGTCATCCTGGATTTAGG - Intronic
1151193918 17:72418447-72418469 GATGAAATCATCCTGGATTCAGG - Intergenic
1151432433 17:74072557-74072579 GATGAATTCATCCTAGATTTGGG - Intergenic
1151447929 17:74179331-74179353 GAAGAGATTATCCTGGATTAGGG + Intergenic
1151629255 17:75299153-75299175 GAGGTAGTCATCCTTGAGTCAGG - Intergenic
1151917310 17:77127794-77127816 GATGAGATCATCGTGGATTTAGG + Intronic
1151957419 17:77387367-77387389 GAGGAGAGTATCCTGGATTTAGG - Intronic
1152133040 17:78488727-78488749 GACAAGATCATCCTGGATTTAGG + Intronic
1152196647 17:78922465-78922487 GATGAAGTCATACTGGATTAGGG + Intronic
1152853546 17:82650737-82650759 GATAAGATCATCCTGGATTTGGG + Intergenic
1153612641 18:6902023-6902045 GATTAAATCATCCTGGATTTAGG - Intronic
1156177657 18:34565730-34565752 GATGAAATCATCCTGCATTAAGG - Intronic
1156400082 18:36731987-36732009 GATGAGGTCATACTGGATTCAGG + Intronic
1156906056 18:42353122-42353144 AAAGTAATCATCATGGATTCAGG - Intergenic
1157989990 18:52483199-52483221 GATGAGGTCATCCTGGATTTAGG - Intronic
1158010143 18:52719186-52719208 GATGAAATCATCCTGTGTTTAGG - Intronic
1158327855 18:56329676-56329698 GATGAAGTCATCCTGAATTTAGG + Intergenic
1158410460 18:57200593-57200615 GATGGAATCATCCTAGATTGAGG + Intergenic
1158444441 18:57506978-57507000 GAAGACATCATGCTAGATTCTGG - Intergenic
1158625479 18:59067710-59067732 GATGAGATCATCCTGGATTAGGG - Intergenic
1158869415 18:61670181-61670203 GATGACATCATCCTGGATTTAGG - Intergenic
1159101333 18:63962499-63962521 AAGCACATCATCCTGGATCCAGG + Intronic
1159202458 18:65204818-65204840 TAGGAAAACATACTGGATTTTGG + Intergenic
1160439091 18:78875405-78875427 GCAGAAATCATGCTGAATTCCGG + Intergenic
1161289909 19:3488060-3488082 CATGAGATCATCCTGGATTTAGG - Intergenic
1161914602 19:7219177-7219199 GGGGAAATTACCCAGGATTCAGG + Intronic
1161936053 19:7372848-7372870 GAGGACCTCAGCCTGGATTTGGG + Exonic
1162734577 19:12739108-12739130 GATGACAACATCCTGGACTCTGG + Intronic
1162882053 19:13667018-13667040 AAGGAAACCCTCCTGGAGTCAGG - Intergenic
1162978899 19:14225764-14225786 AATGAGATCATCCTGGATTAGGG + Intergenic
1163025104 19:14506277-14506299 GATGAGATCATCCTGGATTAGGG + Intergenic
1163782619 19:19258316-19258338 GAGGAACTGTTCCTGGATCCCGG - Intronic
1163888414 19:19989482-19989504 GGAGCAATCATACTGGATTCAGG + Intergenic
1163903977 19:20135039-20135061 GAAGCAATCATACTTGATTCTGG + Intergenic
1164173664 19:22749206-22749228 GAGGAATTAATCCTGAAGTCTGG + Intergenic
1164577823 19:29416399-29416421 GATGAGATCATTCTGGATTGGGG - Intergenic
1166584564 19:43934490-43934512 AAGGAGAGCATCCTGGCTTCTGG - Exonic
925379270 2:3413926-3413948 GAGGTAAAAGTCCTGGATTCTGG - Intronic
925389960 2:3487883-3487905 GATGGAATCATCCTGGACTAGGG - Intergenic
925766553 2:7241921-7241943 GAGAATATCATGCTTGATTCTGG - Intergenic
925840419 2:7986725-7986747 GATGAAGTCATACTGGATTAGGG - Intergenic
926656883 2:15417120-15417142 GAAGAAAACATCTTGGCTTCAGG - Intronic
926810876 2:16754512-16754534 GATGAGATCATCCTGGATTAGGG + Intergenic
927233934 2:20852427-20852449 TATGAGATCATCCTGGATTTAGG - Intergenic
927654401 2:24933207-24933229 GAGGAGATCATCCTGGGTTAAGG - Intergenic
927774117 2:25888762-25888784 GAGCAGCTCTTCCTGGATTCTGG - Intergenic
928356467 2:30620998-30621020 GATGAGATCATCGTGGATTCAGG - Intronic
928783189 2:34849689-34849711 GATGAAGTCATCTTGGATTTAGG + Intergenic
928870000 2:35964702-35964724 GAGGAACTCATCTTGCAGTCAGG - Intergenic
929180295 2:39030801-39030823 GATGAGATCATCTTGGATTAGGG + Intronic
930470728 2:51808794-51808816 GAGAAAATCATACTGAATTCAGG + Intergenic
930999486 2:57763044-57763066 TAGGAAATCATGCTGGATTAGGG - Intergenic
931770153 2:65490440-65490462 GATGAAATCACGCTGGATTAGGG + Intergenic
932870347 2:75392304-75392326 GAGGGAATCCTCCTGTATTAGGG + Intergenic
935132721 2:100273018-100273040 GATGAGGTCATCCTGGATTAGGG + Intergenic
935153408 2:100460620-100460642 AAAGAAATCATCCTGGATGGAGG + Intergenic
935502632 2:103859591-103859613 GATGAAGTCATGCTGGATTCGGG - Intergenic
935600554 2:104917767-104917789 GAGAGAAGAATCCTGGATTCTGG - Intergenic
935632998 2:105227349-105227371 GATGAAGTCATACTGGATTAGGG + Intergenic
935954022 2:108356739-108356761 GAGAAGATTTTCCTGGATTCTGG - Intergenic
936833899 2:116683663-116683685 GAGGAGATCATACTGAATTAGGG - Intergenic
938322802 2:130376421-130376443 GATGAAATCATCCTGTATTTAGG + Intergenic
940445532 2:153772250-153772272 GAGGAAATCATTTTCAATTCAGG - Intergenic
940852725 2:158703740-158703762 GAAGAAATCATCCTGGTTTTAGG - Intergenic
941303511 2:163831530-163831552 GATGAGATCATCCTGGATTAGGG - Intergenic
941909090 2:170745088-170745110 GATGAAGTCATACTGGATTAGGG - Intergenic
942860034 2:180598376-180598398 GATGAAATCATACTGGAGTAGGG - Intergenic
942978148 2:182044156-182044178 GAGGAGTCCATCCTGGATACAGG - Intronic
943088037 2:183338068-183338090 GAGTAGATCACCCTGGATGCAGG + Intergenic
943474959 2:188342439-188342461 GATAAAATCATCCTGGATTTAGG - Intronic
944472814 2:200073057-200073079 GAAGAAATCATCCTAAATTTAGG - Intergenic
946337304 2:219046628-219046650 GTGGAAGTCAGCCTGGACTCAGG + Intergenic
946566796 2:220974505-220974527 GATGAAATTATCCTGGATTAGGG + Intergenic
946784912 2:223233701-223233723 GATGAGATCATCCTGGATTAGGG + Intergenic
947134652 2:226965116-226965138 GATGAGATCATCCTGGGTTAGGG + Intronic
947211099 2:227709535-227709557 TAGAAAATCACCCTGGCTTCAGG - Intronic
947617526 2:231568104-231568126 GATGACATCATCTTGGATTTAGG - Intergenic
947796311 2:232896219-232896241 GATGAGATCATCCTGGGTTAAGG + Intronic
947922886 2:233893646-233893668 GATGAGATCTTCCTGGATTAGGG - Intergenic
947985904 2:234447256-234447278 GATGAAGTCCTCCTGGATTTAGG + Intergenic
948382122 2:237558097-237558119 GATGAGGTCATCCTGGATTAAGG - Intergenic
948390176 2:237606289-237606311 CATGAGGTCATCCTGGATTCAGG + Intergenic
948504892 2:238422082-238422104 GATGAGATCGTCCTGGATTTAGG - Intergenic
948525859 2:238570428-238570450 GAGGAGATGGTCCTGGATTAGGG + Intergenic
948528510 2:238588250-238588272 GATGAGATCTTCCTGGATTAGGG - Intergenic
948761729 2:240196608-240196630 GACGAAATCATCTTAGATTTAGG + Intergenic
948783487 2:240339256-240339278 GATGAGATCACCCTGGATTTAGG + Intergenic
1169256091 20:4100243-4100265 GATGAAATCATACTGGATTAGGG - Intergenic
1169886051 20:10399014-10399036 GATGACATCATCCTGGATTTAGG + Intergenic
1169951778 20:11052534-11052556 GTGGGAATCATCCTCCATTCAGG - Intergenic
1170271424 20:14531264-14531286 GAGGAAATAATCCTGGATTCAGG + Intronic
1170879249 20:20280127-20280149 GAGAAAGTCATCCTGGATCAAGG + Intronic
1171206924 20:23288583-23288605 GAGGTCATTCTCCTGGATTCTGG + Intergenic
1172084872 20:32373440-32373462 GAGGTAAGCATCCTTCATTCTGG - Intronic
1172585945 20:36084699-36084721 GAATAACTCATCCTGGATTTAGG - Intergenic
1172814751 20:37677541-37677563 GTTGAAATCATCCTGGATTTAGG + Intergenic
1173157432 20:40626112-40626134 GGTGAGATCATCCTGGATTAGGG - Intergenic
1173157546 20:40627311-40627333 GGTGAGATCATCCTGGATTAGGG - Intergenic
1173368807 20:42416110-42416132 GATGAGATCATCCTGGAGTAGGG + Intronic
1173411082 20:42809793-42809815 GAGGAGGTTATCCTGGATTTAGG - Intronic
1174161625 20:48555003-48555025 GGGGAGATTATCCCGGATTCAGG + Intergenic
1174384365 20:50178338-50178360 GATGAGATCATTCTGGATTGTGG + Intergenic
1174433332 20:50487064-50487086 GGGGAAATCAAGCTGGGTTCTGG + Intergenic
1175072554 20:56346426-56346448 GAGGAAAGCATCATGAATTGTGG - Intergenic
1175113904 20:56668249-56668271 GATGAAATTATCCTGGACTTAGG + Intergenic
1175607682 20:60324218-60324240 GATGAAGTCATCCTGGATTAAGG - Intergenic
1175699649 20:61127721-61127743 GATGAGATCATCCTGGATTTAGG + Intergenic
1175964607 20:62654269-62654291 GAAGAGATCATCCTGGATTAGGG - Intronic
1177017281 21:15807735-15807757 GATGAGATCAGCCTGGATTAGGG - Intronic
1177418444 21:20825031-20825053 GATGATATCATACTGGATTTAGG + Intergenic
1177800020 21:25819558-25819580 GATGAGATCATACTGGATTTGGG + Intergenic
1178719000 21:34991803-34991825 GACGAGGTCATCCTGGATTAGGG + Intronic
1178729807 21:35090905-35090927 GAGGGAAAGATCCTGGGTTCCGG - Intronic
1178786258 21:35656561-35656583 GATGAGATCATCCCGGATTTAGG + Intronic
1178807074 21:35848066-35848088 GATGAAATCATCCTGGATTTAGG - Intronic
1178952732 21:36998504-36998526 GAGGAGATCATTCTGGATTTAGG - Intergenic
1179172495 21:38983375-38983397 GATGAAATCATCCTGGATTGAGG + Intergenic
1179173041 21:38987802-38987824 GATGAAATCATACTGGTGTCTGG - Intergenic
1179186463 21:39088888-39088910 GATGAGATCATCCTGGATGAGGG + Intergenic
1179225374 21:39448158-39448180 GATTAAATCATCCTGGATTTAGG - Intronic
1179282123 21:39942707-39942729 GATGAGATCATCCTAGATTTAGG - Intergenic
1179344522 21:40544424-40544446 GATGAAATCATCCTGAATTTAGG + Intronic
1179385560 21:40938530-40938552 GATGAGATCATCCTGGCTTAAGG - Intergenic
1179531490 21:42022512-42022534 GATGAGGTCATCCTGGATTAGGG + Intergenic
1180747416 22:18099889-18099911 GATGAGATCATCCTGGATTAGGG - Exonic
1180981830 22:19882006-19882028 AATGAAGTCATCCTGGATTAGGG + Intronic
1182455827 22:30449899-30449921 GAGGAAATACTCCTGGATCAGGG + Intronic
1182693173 22:32177532-32177554 TAGTAACTCAGCCTGGATTCAGG - Intergenic
1183111386 22:35651432-35651454 GGTGAAATTATCCTGGATTCAGG - Intronic
1184132293 22:42524111-42524133 GATAAAATCATCTTGGATTTAGG + Intergenic
1184752674 22:46497610-46497632 GATGGGATCATCCTGGATTAGGG - Intronic
1184895875 22:47406079-47406101 GATGAAATCATCCCAGATTTAGG - Intergenic
1184976919 22:48068859-48068881 GATGAGATCGTCCTGGATTAGGG - Intergenic
1185184853 22:49392913-49392935 AATGAGGTCATCCTGGATTCGGG + Intergenic
950014353 3:9745329-9745351 GAGAGAACCATCCTGGATTAAGG + Intronic
951690139 3:25386555-25386577 GATGAAAGTATCCTGGATTCAGG + Intronic
952207143 3:31191549-31191571 GTGGAAATCCTCCTGGGTCCTGG - Intergenic
953341935 3:42141801-42141823 GATGACATCATCCTGGATTGAGG - Intronic
954518967 3:51206146-51206168 GAGGAAAACATTCTGCATTATGG - Intronic
955155382 3:56412046-56412068 GATGAGATCACCCTGGATTTAGG + Intronic
955833528 3:63029376-63029398 GATGAAATCATCCTGGACTTAGG + Intergenic
956774099 3:72550537-72550559 GATGAGATAATCCTGGATTTAGG - Intergenic
957060946 3:75480905-75480927 GATGAAGTCATCCTGGAGTAGGG + Intergenic
957269807 3:78014998-78015020 GAGGAAACCATTCTGGAATTGGG - Intergenic
958513692 3:95083557-95083579 GAGGAAAGCATCCTGTCTTTTGG + Intergenic
958584744 3:96071557-96071579 GATGAGACCATCCTGGATTTAGG - Intergenic
958608736 3:96395582-96395604 GAGGAAATCAGCCTTGATACTGG - Intergenic
958612667 3:96447425-96447447 GATTAAATCATCCTGGGTTTAGG - Intergenic
959018862 3:101166772-101166794 GGGGAGACCATCCTGGATTCAGG + Intergenic
959392195 3:105789781-105789803 TAAGAAATCATCCTGGATATTGG + Intronic
960312816 3:116137216-116137238 AATGAGATCATCCTGGATTAGGG - Intronic
960732916 3:120745666-120745688 TAGGAAATAATCCTGGAAACAGG + Intronic
960765703 3:121127618-121127640 GAAGAAATCATTCTGGATTTAGG - Intronic
961292435 3:125858515-125858537 GATGAAGTCATCCTGGAGTAGGG - Intergenic
961626613 3:128268579-128268601 GAAGAAATCATCCTGGATTAGGG + Intronic
961805218 3:129484256-129484278 GGGGAGACCATCCTGCATTCGGG - Intronic
961894749 3:130157893-130157915 GATGAAGTCATCCTGGAGTAGGG + Intergenic
962794528 3:138838891-138838913 GATGAGATCATCCTGGATGTAGG + Intergenic
962929995 3:140027289-140027311 GATGAAGTCATACTGGATTAAGG + Intronic
963558861 3:146834275-146834297 GATGAGATCATCATGGATTAAGG - Intergenic
964817347 3:160730984-160731006 AAGGAGATTATCCTGGATTATGG - Intergenic
965508997 3:169547709-169547731 GACTAGATCATCCTGGATTTAGG + Intronic
965622863 3:170658162-170658184 GATGAGATCATCTTGGATTTAGG - Intronic
967262596 3:187658302-187658324 GAGGAAATTATCCTGGATTGAGG + Intergenic
967540068 3:190656773-190656795 GAGGCAATAATTCTGGATTCAGG - Exonic
968026192 3:195444103-195444125 GAGGCAAACTTCCTGGATTTAGG + Intergenic
968318322 3:197743013-197743035 GGGGAATTCTTCCTGGACTCAGG - Intronic
969170230 4:5356326-5356348 GATGAAATCATCCTGGATTTAGG - Intronic
969450378 4:7269488-7269510 GATGAGATCATCCTGGACTTAGG + Intronic
969748027 4:9089203-9089225 GATGAAGTCATCCTGGAGTAGGG - Intergenic
969839662 4:9871608-9871630 GATGAAGCCATCCTGGATTTAGG - Intronic
970232298 4:13923176-13923198 GAGGAGATCATACTGGATTAGGG - Intergenic
970327675 4:14944378-14944400 GGTGAAATTATCCTGGATTTAGG + Intergenic
970370744 4:15403613-15403635 GATGAGATCATCCTGGATTAGGG - Intronic
970439237 4:16065899-16065921 GATGAGATCATCCTGGACTTGGG + Intronic
970485587 4:16521447-16521469 CATGAAATCATTCTGGATTTAGG - Intronic
970523449 4:16908376-16908398 GATGAAGTCATACTGGATTAGGG + Intergenic
970784721 4:19782489-19782511 GATGAGATCATCCTGGATTTAGG - Intergenic
971243630 4:24910325-24910347 GATGAGATCACCCTGGATTTAGG - Intronic
971305852 4:25480621-25480643 GACTAAATCATCTTGGATTTAGG - Intergenic
972957587 4:44411667-44411689 GATGAAATCATACTGGAGTAGGG + Intronic
972987289 4:44780048-44780070 GATGAGATTATCCTGGATTAGGG - Intergenic
973843438 4:54886452-54886474 GATGAAGTCATACTGGATTAGGG - Intergenic
974296755 4:60009991-60010013 GATGAGATCATCCTGCATTTAGG - Intergenic
975101378 4:70517275-70517297 GAGGAGATCATCCTTGAGTTTGG - Intergenic
975478948 4:74856521-74856543 GAAGAAATCATCCTAGACTTAGG - Intergenic
976764777 4:88588811-88588833 GAGGAAATCAGCATGTGTTCAGG + Intronic
977588636 4:98802591-98802613 GATGACATCTTCTTGGATTCAGG - Intergenic
978338662 4:107697849-107697871 GAGGAGGTCATACTGGATTAGGG + Intronic
979203633 4:118008722-118008744 GATGAAATCATCCTGAGTTTAGG + Intergenic
982459637 4:155652675-155652697 GATGAAATCATCCTGGATTAAGG + Intergenic
982567357 4:157002473-157002495 GAGGAACTCAAACTGGATTAGGG - Intergenic
983084431 4:163426313-163426335 GAGGGAATCACCCTGAAGTCTGG + Intergenic
983437822 4:167737845-167737867 AAGGAAATGATCCTCCATTCAGG - Intergenic
984790432 4:183609929-183609951 GATGAACTCTTCCTGGATTTAGG - Intergenic
984990979 4:185380603-185380625 GAGGAAGTCATGTTGGATTAGGG - Intronic
985768014 5:1791174-1791196 GATGAAATTATCCTGGATTAGGG + Intergenic
985913169 5:2898414-2898436 GATGAAGTCATCCTGGATTCAGG - Intergenic
986077983 5:4357661-4357683 GAAGAATTCTTCCTGGATTAGGG - Intergenic
986321809 5:6637563-6637585 GAGCAAAGCAGCCTGGGTTCAGG - Intronic
986349037 5:6859818-6859840 GATGAGATCATCCTGGATTTAGG - Intergenic
986414446 5:7514647-7514669 GATGAAGTCATACTGGATTTAGG + Intronic
986802499 5:11276706-11276728 GAGGAAATCATCCTGGATTCAGG + Intronic
987046346 5:14112910-14112932 GAGGATGTAAGCCTGGATTCTGG - Intergenic
988224165 5:28390623-28390645 GATGAGATTATCCTGGATTTAGG - Intergenic
988522608 5:31960027-31960049 GAGGAGATCATCCTGGATTAGGG - Intronic
988955360 5:36310991-36311013 GATAAAATCTTCCTGGATTACGG + Intergenic
989156316 5:38348016-38348038 GAGGAAAGCATCAAGAATTCTGG + Intronic
989378016 5:40785754-40785776 GATGAAATCTTACTGGATTTAGG + Intronic
989720282 5:44519880-44519902 GATGAGATCATCCTGGATTTAGG - Intergenic
990828556 5:59930282-59930304 GGTGAAATCATCCTGGATTAGGG + Intronic
991635590 5:68701578-68701600 GAGGAAACCTGCCTGGAGTCAGG - Intergenic
992439350 5:76784568-76784590 GAGGGAGTCTTCCAGGATTCTGG + Intergenic
992650968 5:78859785-78859807 GAGGAAAGCAGCCAGCATTCGGG - Intronic
992901127 5:81297613-81297635 GAGGAAATCATACCAGATACGGG - Intergenic
992969968 5:82046294-82046316 GATGAAGTCATGCTGGATTAGGG + Intronic
993201705 5:84825064-84825086 GAGAAAATCATCTTGGGTTGTGG + Intergenic
993332487 5:86617876-86617898 GCGGAAATCGCCCTGGATTGTGG - Intergenic
993990244 5:94648039-94648061 GATTAATTCATCCTGTATTCTGG + Intronic
994950294 5:106453071-106453093 GATGAGATCATTCTGGATTTAGG + Intergenic
995465764 5:112448184-112448206 AAGGAATTAATCCTGAATTCTGG + Intergenic
995673786 5:114639040-114639062 GATGAAATCACACTGGATTAGGG + Intergenic
996398996 5:123039543-123039565 GATGAAATCATACTGGAGTAGGG + Intergenic
996810832 5:127514980-127515002 GATGATATCATTCTGGATTTAGG + Intergenic
997925218 5:138024229-138024251 GAGGAAATCATCCTAGATTTAGG + Intronic
999074789 5:148784119-148784141 GATGAAATTATACTGGATTAAGG - Intergenic
999359854 5:150974333-150974355 GATGAAATCATCCTGGGTTTAGG - Intergenic
999635762 5:153620554-153620576 GAGGAAATAGACCTGGATCCAGG + Intronic
1001312608 5:170622268-170622290 GATGAAATCATCTTGGATTTGGG + Intronic
1001772150 5:174304624-174304646 GAGGAAATAATCCTGGGTTTAGG - Intergenic
1003476638 6:6489770-6489792 GATAAAATCTTCCTGGATTTAGG + Intergenic
1003821231 6:9899128-9899150 GATGAGATCATCCTGAATTTAGG - Intronic
1004603586 6:17173795-17173817 GATTAAATTATCCTGGATTTAGG + Intergenic
1004675672 6:17839652-17839674 GATGAGATCATACTGGATTAGGG + Intronic
1005102836 6:22191809-22191831 GATGAGACCATCCTGGATTAGGG - Intergenic
1005329532 6:24736188-24736210 GATGTAATCATCCTGGATTTAGG + Intergenic
1005609182 6:27507100-27507122 GAGAAGATCATGCTGGATTCAGG + Intergenic
1005810118 6:29508979-29509001 GGTGAAATCATCCTGGATTTAGG - Intergenic
1005879923 6:30048839-30048861 GAAAAGATCATCCTGGATTTAGG + Intergenic
1007972623 6:46067994-46068016 GATGAAATCATCCTGAGTTAAGG + Intronic
1008004790 6:46399801-46399823 GATGAGATCATCCTGGATTAAGG - Intronic
1008779807 6:55089832-55089854 GACAAAATCATCCTGGATTCAGG - Intergenic
1009459410 6:63894269-63894291 GATGAGACCATCCTGGATTAGGG + Intronic
1011248959 6:85350023-85350045 GGTGAAATCATCCTGGATTTAGG - Intergenic
1011292222 6:85788763-85788785 GATGAGATCATCCTGGATCATGG + Intergenic
1011553231 6:88548718-88548740 GATAAGATCATCCTGGATTTAGG - Intergenic
1012115279 6:95289070-95289092 GATGAAATCATACTGGAATAGGG + Intergenic
1014780568 6:125560024-125560046 GATGAGCTCATCCTGGATTTAGG + Intergenic
1015138596 6:129903043-129903065 GACAAAATCACCCTGGATTCAGG - Intergenic
1015308496 6:131737049-131737071 GATGAGATTATCCTGGATTTAGG - Intronic
1015360648 6:132335405-132335427 GAGGAGATCATACTGGATTAAGG + Intronic
1015547005 6:134371463-134371485 GATGAAGTCATCTTGGATTAGGG - Intergenic
1016019278 6:139218815-139218837 GAAGAAGTCATCATGGCTTCTGG + Intergenic
1016743878 6:147557630-147557652 GATGAAATTATCCTGGATTTAGG - Intronic
1017941897 6:159060676-159060698 GATGAGATCATCCTGGATCAGGG + Intergenic
1018115277 6:160577744-160577766 CAGGAAATCATCCTACATTTAGG + Intronic
1019549992 7:1597430-1597452 GATGAGGTCATCCTGGATTCAGG - Intergenic
1019798356 7:3068993-3069015 GGTGAAATCATTCTGGATTTAGG + Intergenic
1019819372 7:3230427-3230449 GGTGAAATCACCCTGGATTTAGG - Intergenic
1020110544 7:5445590-5445612 GAGGAGATCATCCTGGGCTTAGG + Intronic
1020324982 7:6967431-6967453 GATGAAGTCATCCTGGAGTAGGG + Intergenic
1021428510 7:20532135-20532157 GAGGAAATCTTCCAGGCTTTTGG - Intergenic
1021772648 7:24020792-24020814 GATTAAATCAACCTGGATTTAGG + Intergenic
1021922268 7:25497256-25497278 GAGGAAATCATCCTTTATTAGGG + Intergenic
1022148408 7:27571723-27571745 GAGAAAATCATCCTTAATCCAGG - Intronic
1022154303 7:27643946-27643968 GATGAGATCATCGTGGATTTAGG - Intronic
1022548602 7:31213242-31213264 GATGAATTCAACCTGGATTCAGG + Intergenic
1023029557 7:36080425-36080447 GATGAGATCATTCTGGATTTAGG - Intronic
1023566953 7:41532910-41532932 GATGAGATCATCCTGGAGTCAGG - Intergenic
1024535001 7:50423151-50423173 GAGGAAATCATTCTGGATTTAGG + Intergenic
1024600447 7:50975857-50975879 GATGAGATCATCCTGGATTTAGG + Intergenic
1024984485 7:55183410-55183432 AATGAAATCATCCTGGATTTAGG - Intronic
1025236780 7:57239903-57239925 GATGAAATAATCCTGGAGTGGGG + Intergenic
1027770211 7:82397122-82397144 GATGAAAGCCTCCTGGATTTTGG - Intronic
1027959175 7:84921236-84921258 GATAAAATCATCTTGGATTTAGG + Intergenic
1028137081 7:87233108-87233130 GAGGAAATCATCTTGGATTGGGG + Intergenic
1028213001 7:88098512-88098534 GAGGAAGTCATGCTAGATTAGGG + Intronic
1028358380 7:89937446-89937468 GATGAAATTATCTTGGATTTAGG + Intergenic
1029044200 7:97610422-97610444 GTGGTAAGCATCCTGGACTCTGG - Intergenic
1029152368 7:98490048-98490070 GATGAAATCATCCTGGATTTAGG + Intergenic
1029173999 7:98651131-98651153 GATGGGATCATCCTGGATTTGGG + Intergenic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1031463935 7:122085043-122085065 TATGAAATCAACCTGGATTTAGG + Intronic
1032385235 7:131518087-131518109 GATGAAGTCATACTGGATTAGGG - Intronic
1032728898 7:134618122-134618144 GATGAGATTATCCTAGATTCAGG + Intergenic
1032985095 7:137328888-137328910 GAAGAAATATTCCTGGATACTGG + Intronic
1033412092 7:141127405-141127427 GATGAGATCATCCTGGATTTGGG + Intronic
1034090023 7:148355020-148355042 GTGGAAAGCATCCTGCATCCAGG + Intronic
1035226868 7:157438513-157438535 GATGAAGTCATCCTGGAGTTGGG + Intergenic
1036106117 8:5842220-5842242 GGCGACATCAGCCTGGATTCTGG + Intergenic
1036504561 8:9343635-9343657 GATGATATCATCCTGGATTTAGG + Intergenic
1037042573 8:14255162-14255184 GAGGAAATCTTCCAGGAATGAGG - Intronic
1037484830 8:19337466-19337488 GATGAGATCACCCTGGATTTAGG + Intronic
1037660048 8:20918640-20918662 GATGAGATTATCCTGGATTAGGG + Intergenic
1038543351 8:28407174-28407196 GATAAAATCATCCTGGACTCTGG + Intronic
1041487103 8:58391686-58391708 GATGAGATCATCTTGGATTAGGG + Intergenic
1041774831 8:61512304-61512326 GATGAGATCAACCTGGATTAGGG + Intronic
1041802454 8:61814570-61814592 GATGAGATTATCTTGGATTCAGG + Intergenic
1042746816 8:72117508-72117530 GGTGAAATCATGCTGGATTTAGG - Intronic
1044627202 8:94245661-94245683 AACGAAATCATCCTGGATTAAGG - Intergenic
1044728702 8:95213511-95213533 GATGAAATCATCTAGGATTTAGG + Intergenic
1045377923 8:101593715-101593737 GATAAGATCATCCTGGATTAAGG + Intronic
1046690789 8:117282269-117282291 GATGAGATCATCCTGGATTAGGG - Intergenic
1047197569 8:122735309-122735331 GAGGAGATCATGCTGGATTAGGG - Intergenic
1047275926 8:123404889-123404911 AATGAGATCATTCTGGATTCAGG - Intronic
1047372467 8:124267221-124267243 GTGGAAATGACGCTGGATTCTGG + Intergenic
1047715587 8:127592037-127592059 GAGGAAATTATCCTGGAAAGGGG - Intergenic
1047805007 8:128350339-128350361 GAGGACAGGATTCTGGATTCAGG - Intergenic
1047827824 8:128596730-128596752 GAGGAAATGATCTTGGATCTTGG + Intergenic
1047957575 8:129987108-129987130 GAGGCCATCAGCTTGGATTCAGG - Intronic
1048331683 8:133475078-133475100 CATGAGATCATCCTGGATTAGGG + Intronic
1048743130 8:137584526-137584548 GAAGAAATCATCCTGGATTATGG + Intergenic
1048859936 8:138716715-138716737 GAGGAATTAATCCTGGTTTTTGG - Intronic
1049459972 8:142722114-142722136 GGGGCAAGCATCCTGGCTTCTGG - Intergenic
1049941557 9:550871-550893 CAGGAAATTATTCTGGAGTCTGG - Intronic
1050920524 9:11196519-11196541 GATGAGGTCATCCTGGATTTAGG + Intergenic
1052077037 9:24155966-24155988 GAGGAAAACATTCAGAATTCAGG + Intergenic
1052262709 9:26536388-26536410 AAGGAAATCTTCCAGGTTTCTGG + Intergenic
1052279704 9:26718973-26718995 GATGAAATCATCCTGGGTTTAGG + Intergenic
1055577630 9:77676175-77676197 GAGGAAATCAGCCTGGGCTGTGG - Intergenic
1056137272 9:83642689-83642711 GAGGCAGTCATCCTGGGGTCAGG - Intronic
1056719038 9:89057878-89057900 GATGAGATTATCCTGGATTAGGG + Intronic
1056783116 9:89566258-89566280 GATGAGATCATACTGGATTAGGG + Intergenic
1056877417 9:90347829-90347851 TAGGAAACCATCCTGGGCTCAGG + Intergenic
1057457011 9:95223454-95223476 GATGAAGTCATACTGGATTAAGG - Intronic
1057495014 9:95553747-95553769 GAGGAGATCATCCTGGAGTTAGG + Intergenic
1057559480 9:96116079-96116101 GATGAGATCATCCTGGATTTAGG - Intronic
1058633942 9:107018483-107018505 GAGGAAATCATTCTGGATTAGGG - Intergenic
1059526235 9:114993238-114993260 CATGAAATCCTCCCGGATTCAGG + Intergenic
1059744631 9:117188210-117188232 GAGGAAATCACCCCCGATCCTGG + Intronic
1059812200 9:117867796-117867818 GAGGCAATCATGCTGATTTCAGG - Intergenic
1061609687 9:131738515-131738537 GAGAAAAGCACCCTGGCTTCTGG + Intronic
1061980517 9:134100589-134100611 GAGGACAACATCCTAGATACAGG + Intergenic
1062261682 9:135666053-135666075 GTGAAAAGCATCCTGGAGTCGGG + Intronic
1185445228 X:254341-254363 GATGAGATCATCCTGGAGTAGGG - Intergenic
1185455739 X:309874-309896 AATGAGATCATCCTGGATTAGGG + Intronic
1185455797 X:310214-310236 GATGAGATCATCCTGGATTAGGG + Intronic
1185455857 X:310553-310575 AATGAGATCATCCTGGATTAGGG + Intronic
1185500850 X:596223-596245 GATGAGATCATCCTGGAGTAGGG + Intergenic
1185511183 X:666276-666298 GATGAGATCATCCTAGATTAGGG + Intergenic
1185527961 X:794219-794241 GATGAGATCATCCTGCATTAGGG + Intergenic
1185530444 X:814302-814324 GAGGAAATCGTCTTGGATTAGGG + Intergenic
1185530504 X:814641-814663 GAGGAAATCGTCTTGGATTAGGG + Intergenic
1185530565 X:814980-815002 GAGGAAATCGTCTTGGATTAGGG + Intergenic
1185536876 X:869415-869437 GATGAGATCATCCTGGATTAGGG - Intergenic
1185561208 X:1061809-1061831 GATGAGATCATCCTGGAGTATGG - Intergenic
1185577310 X:1184230-1184252 GATGAGATCATCCTGGAGTTGGG - Intergenic
1185630608 X:1513925-1513947 GATGAGATCATCCTGGATTAGGG - Intronic
1185639400 X:1578553-1578575 GATGAGATCATCCTGGAGTAGGG + Intergenic
1185653652 X:1667252-1667274 GAGGAGATCATCCTGGAGCAGGG - Intergenic
1185675103 X:1842817-1842839 GAGGAGGTCATGCTGGATTCAGG + Intergenic
1185677510 X:1860653-1860675 GATGAAATCATCTTAGATTCAGG - Intergenic
1185680523 X:1885075-1885097 GATGAGATCATCCTGGATTAGGG - Intergenic
1185698897 X:2215560-2215582 GATGAGATCATCCTGGAGTAGGG + Intergenic
1185698946 X:2215899-2215921 GACGAGATCATCCTGGAGTAGGG + Intergenic
1185699047 X:2216543-2216565 GATGAGATCATCCTGGAGTAGGG + Intergenic
1185704926 X:2259865-2259887 GATGAGATCATCCTGGAGTAGGG - Intronic
1185722919 X:2396206-2396228 GATGAGATCATTCTGGATTAGGG - Intronic
1185888175 X:3801691-3801713 GATGAGCTCATCCTGGATTAGGG + Intergenic
1185924092 X:4127415-4127437 GATGAGATCATCTTGGATTAGGG - Intergenic
1186029576 X:5353318-5353340 GATGAAGTCATACTGGATTAGGG - Intergenic
1186401332 X:9262919-9262941 TAGGAAATCATCCTGGGATCAGG + Intergenic
1186896994 X:14013543-14013565 GATGAGATCATACTGGATTAGGG + Intronic
1187151628 X:16686501-16686523 GCTGAGATCATCCTGGATTAGGG + Intronic
1188532715 X:31160308-31160330 GACTAAATCATTCTGGCTTCTGG + Intronic
1188766486 X:34099099-34099121 GAGGAATTTCTCCTGTATTCAGG - Intergenic
1189161534 X:38814072-38814094 AGGGAGATCATCCTGGATTATGG + Intergenic
1189246247 X:39565728-39565750 GATGAGATCATCCTGGATCAAGG + Intergenic
1189577384 X:42368876-42368898 GATGAGATCATCCTGAATTTAGG + Intergenic
1189876064 X:45437397-45437419 GATGAGATCATCCTGGACTATGG + Intergenic
1189969236 X:46401167-46401189 GATGAAATCATCTTAGATTTAGG + Intergenic
1191963710 X:66731953-66731975 TAGGAAGTCTTCCTGTATTCTGG + Intergenic
1192572273 X:72216126-72216148 GATGAGATCATACTGGATTAGGG + Intronic
1192939861 X:75901134-75901156 AAGGAATTAATCCTGGAGTCTGG - Intergenic
1193790541 X:85810858-85810880 GAGGATATCCTTCTGAATTCTGG + Intergenic
1194832221 X:98637684-98637706 GATGAGATCATCCAGGATTTAGG + Intergenic
1194855337 X:98920545-98920567 AATGAAATCATACTGGATTAGGG + Intergenic
1195958850 X:110364262-110364284 CATGAGATCATCCTGGATTAGGG - Intronic
1196110743 X:111944605-111944627 GATGAGGTCATCCTGGATTAGGG + Intronic
1196126158 X:112101756-112101778 GAGGAGGTCATACTGGATTAGGG + Intergenic
1196988849 X:121305404-121305426 AAGGAATTCATCCTTGATGCAGG - Intergenic
1197629845 X:128845841-128845863 GCTGAGATCATCCTGGATTTAGG - Intergenic
1197863724 X:130996685-130996707 GATGAAATCATCTTGGATTTGGG + Intergenic
1199474061 X:148226975-148226997 GATGAAATCATCCTGGATTTAGG + Intergenic
1199511387 X:148626795-148626817 GATGAAATCATTCTGAATTTAGG - Intronic
1199520078 X:148725305-148725327 CAGGAAATCACACTGGATGCAGG - Intronic
1199722470 X:150551805-150551827 GGTGAAATCATCCTGGATTTAGG - Intergenic
1199925060 X:152453592-152453614 GATGAAATCATTCCGGATTTAGG - Intergenic
1200169716 X:154063776-154063798 TATGAGATCATCCTGGATTTAGG + Intronic
1200797158 Y:7351302-7351324 GACGAAATCATCCTGGAATAGGG - Intergenic
1200944452 Y:8819619-8819641 GAGGAAGTTATTCTAGATTCAGG + Intergenic
1201236943 Y:11921061-11921083 GATGAAGTCATGCTGGATTCAGG + Intergenic
1201906674 Y:19092666-19092688 GATGATATCATCCTGGATTAGGG - Intergenic