ID: 986802611

View in Genome Browser
Species Human (GRCh38)
Location 5:11277829-11277851
Sequence ACAGCATAAAAGCCTAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986802611 Original CRISPR ACAGCATAAAAGCCTAAAGC AGG (reversed) Intronic
902353851 1:15881263-15881285 ACAGAATAAAACCCAAAAGTTGG - Intronic
903019035 1:20380804-20380826 ACTGCAGAAAAGCCTTCAGCTGG - Intergenic
903223034 1:21879452-21879474 ACAGAAGAAAAGGCTCAAGCAGG - Intronic
910035851 1:82787354-82787376 ACAGCACAAAAGGGGAAAGCTGG + Intergenic
912348270 1:108986580-108986602 ACAGCATATAAACCTCCAGCTGG + Exonic
912578524 1:110698510-110698532 GCAGAATAGAAGCCTAAAGAGGG + Intergenic
916284438 1:163089699-163089721 ACCTCCAAAAAGCCTAAAGCTGG - Intergenic
918353655 1:183684309-183684331 CCAGCATCAAAGACCAAAGCTGG - Intronic
918716213 1:187790027-187790049 ACAGAATAATAGACTAAATCAGG + Intergenic
919038534 1:192349684-192349706 ACAGCTTAAAAAACTAAACCTGG - Intronic
919878073 1:201885121-201885143 ACAGCAAGAAAGATTAAAGCTGG + Intergenic
1062883691 10:999656-999678 ACAGTTTAAAAGCGTGAAGCAGG + Intronic
1063556423 10:7084042-7084064 ACATCATAAATGCCTGGAGCTGG + Intergenic
1064629739 10:17297450-17297472 ACAGTCTCAAAGCTTAAAGCTGG - Intergenic
1068567022 10:58587649-58587671 ACAACATAGAGGGCTAAAGCTGG - Intronic
1071359639 10:84833297-84833319 ACAACATTAAGTCCTAAAGCTGG - Intergenic
1071428250 10:85581246-85581268 TCAGCATACAAGCCTAATACAGG + Intergenic
1071941539 10:90596608-90596630 ACAACTTAAAAGGCTACAGCAGG - Intergenic
1073201016 10:101735539-101735561 ACAGCATCAAAGTCTAAACCTGG - Intergenic
1073586811 10:104718249-104718271 ACAGCAAAAAGGCCTACACCAGG - Intronic
1075290718 10:121228382-121228404 ACATCATTAAATCTTAAAGCTGG + Intergenic
1075575021 10:123571726-123571748 CTAGCAGAAAAGCCTAAATCAGG - Intergenic
1078862915 11:15269402-15269424 ACACCATAAGTGCCTAAAGATGG - Intergenic
1078895753 11:15595518-15595540 ACAGAATAAAAGCCTAATTTAGG - Intergenic
1080279408 11:30539481-30539503 GCAGCATAAAATCCCAAAGCAGG + Intronic
1083230471 11:61314692-61314714 ACAGCTTACAAACCTACAGCTGG + Intronic
1087010599 11:93510549-93510571 ACAGCATACAAGCCTACATCTGG - Intronic
1087833000 11:102840147-102840169 ACAGCATCAAAGGACAAAGCAGG + Exonic
1093392550 12:18640230-18640252 ACAGTTTAAAAGAGTAAAGCTGG - Intronic
1095773464 12:45988188-45988210 ACATCTTAAAAGACAAAAGCAGG + Intronic
1095817367 12:46439491-46439513 ACAGCATAAATGCCCAGAGTGGG - Intergenic
1096376891 12:51119882-51119904 ACAGCATAAAAGCAAAAACTAGG + Intronic
1096483002 12:51955067-51955089 AAACCAATAAAGCCTAAAGCAGG - Intronic
1098061499 12:66568061-66568083 TCAGCATAAAAGGCTAAAGTAGG + Intronic
1098391521 12:69974179-69974201 AAAGCACAAAAGCTTAGAGCCGG - Intergenic
1098816215 12:75166900-75166922 AGAGCAAATAAGCCCAAAGCAGG + Intronic
1099743350 12:86669493-86669515 ACAGCCTAAAACCCTAATCCAGG - Intronic
1100471360 12:94896281-94896303 AGAGCATCAGAGCCAAAAGCTGG + Intergenic
1101070015 12:101063969-101063991 ACATCATTAAAACCAAAAGCTGG - Intronic
1101086129 12:101238893-101238915 ACAGAAAAGAAGCATAAAGCAGG + Intergenic
1101575366 12:105992323-105992345 AAAACATAAAACCCCAAAGCTGG - Intergenic
1101644995 12:106623322-106623344 ACACTATAAAAGACTAATGCTGG - Intronic
1103914300 12:124368579-124368601 ACAGCAGAGAGGCCTATAGCAGG - Intronic
1105435549 13:20374796-20374818 ATAGCATAAAAGGCTAGAGTGGG + Intergenic
1105813542 13:24013932-24013954 ACAGCACAACAGCTTAAAACAGG - Intronic
1107168647 13:37314016-37314038 ACACCATAAAAGGCTATAACAGG - Intergenic
1107487531 13:40843588-40843610 ACATCATAACAGGCAAAAGCTGG + Intergenic
1108497191 13:51036552-51036574 ACTGTATAAAAGACTAAAACAGG - Intergenic
1108813270 13:54257036-54257058 AGAGCATAAAAGCCAACAGAAGG - Intergenic
1113390045 13:109887334-109887356 CCAGCATAAAAAACTAAAGTTGG - Intergenic
1113651020 13:112034288-112034310 ACAGCAGGAGAGCCTGAAGCGGG - Intergenic
1113684273 13:112270876-112270898 AAAGCATAACAGCCTCAAGTGGG - Intergenic
1115344846 14:32331494-32331516 AGAGCACAAAAGCATAAAGTTGG - Intronic
1116474922 14:45328710-45328732 ACTGGATAAAAGCCTACAACTGG - Intergenic
1118246302 14:64114460-64114482 ACAACATAACAGGCTACAGCAGG - Intronic
1118267401 14:64307870-64307892 AAATCAATAAAGCCTAAAGCTGG - Intronic
1118284214 14:64456557-64456579 TCAGCAGAAAACCCTAAAGATGG - Intronic
1118574188 14:67225033-67225055 AAAGAAAAAAAGCCAAAAGCAGG - Intronic
1120136458 14:80875952-80875974 ATAGCATAAAAGTGAAAAGCGGG + Intronic
1120136543 14:80877024-80877046 ATAGCATAAAAGTGAAAAGCGGG + Intronic
1121738054 14:96232397-96232419 ACAGCCTGAAAGCCTCTAGCTGG - Intronic
1122613913 14:103003866-103003888 ACAGCATAAAGGAATAAAGCCGG + Intronic
1124621778 15:31278165-31278187 ACTGCATAATGGCCTCAAGCTGG - Intergenic
1126362812 15:47863645-47863667 ACAGCATATGGCCCTAAAGCAGG + Intergenic
1126833395 15:52633923-52633945 ATAGCATAAAGGCCCAAAGAAGG + Intronic
1127408000 15:58673241-58673263 CCAGCATGAAAATCTAAAGCAGG + Intronic
1128047805 15:64634400-64634422 AAAGGATAAAAGCCCACAGCTGG - Intronic
1128242702 15:66111925-66111947 ACAGCATAAAATCCCAAATCAGG + Intronic
1129300855 15:74624657-74624679 AGAACATAAAAGCCTAAGGATGG + Intronic
1137625066 16:49902528-49902550 AGAGCATTAAAGCCTGAAGGTGG + Intergenic
1139681206 16:68565242-68565264 ACAGCCTATAAGGGTAAAGCTGG + Exonic
1144941906 17:18947908-18947930 ACACCCTAAAAGCCTAACCCTGG - Intergenic
1145930978 17:28685286-28685308 ACACCCTGAAAGGCTAAAGCAGG - Intronic
1147195563 17:38764228-38764250 AAAGCATCAAAGACAAAAGCAGG - Exonic
1147732873 17:42614733-42614755 ACAGCAAAAAAGCTAGAAGCAGG - Intronic
1153386014 18:4497151-4497173 ACAGCTTAAATGCCTGAAACAGG + Intergenic
1153877925 18:9392392-9392414 ACAGAAGAAAAGTCTGAAGCTGG - Intronic
1157742997 18:50109840-50109862 ACAACATAAACACCCAAAGCAGG + Intronic
1157751802 18:50185420-50185442 TCAGAATAAATTCCTAAAGCTGG - Intronic
1159373456 18:67560193-67560215 ACAACAGAAAAGCCTAAAATGGG + Intergenic
1160927078 19:1551817-1551839 ACATCAGAAACGCCTAGAGCAGG + Intergenic
1161717833 19:5886752-5886774 CCAGCCTTAAAGCCTAAAGCCGG - Intronic
1163569900 19:18075099-18075121 GCAGCAAAAAACCCTAAAGTGGG + Intronic
1163720866 19:18897586-18897608 ACAGCAGAAAAGCCCACAGGCGG - Intergenic
927361992 2:22246729-22246751 ACAACAAAAAAGCAGAAAGCAGG + Intergenic
932719423 2:74127615-74127637 ACACTGTAAAAGCCTAAAACGGG + Intergenic
936761222 2:115785778-115785800 AAAGCATAAAAACCAAAAGTTGG - Intronic
937518139 2:122679197-122679219 AAAGCATTAAAGACAAAAGCAGG - Intergenic
938659787 2:133473877-133473899 AGAGCAAAAATGCATAAAGCAGG + Intronic
939376710 2:141378037-141378059 TCAGCATAAAAGTCAAAAGCAGG - Intronic
941156955 2:161991024-161991046 ACAGCATAAAAACCTAAAAATGG - Intergenic
941645997 2:168042203-168042225 ACAGTATGAAAGCATAAAGTAGG - Intronic
943565997 2:189517557-189517579 ACTGAACAAAGGCCTAAAGCGGG + Intergenic
945489904 2:210442748-210442770 ACAGCACAAAACCCAAAAGTAGG + Intronic
948548538 2:238751080-238751102 ACAACATAAAAGCCAAAAGACGG + Intergenic
1168782927 20:509970-509992 ACAGCATAAAAGACAAATGGAGG + Intronic
1169309597 20:4523956-4523978 ACAGCACAATAGCCGAAAGATGG + Intergenic
1170336884 20:15280188-15280210 ACAGCACAAATGCATAAAGATGG + Intronic
1171945916 20:31377508-31377530 GCATCATAAAAACCTAAAGGGGG + Intronic
1173749168 20:45463040-45463062 ACAGCAAACCATCCTAAAGCTGG + Intergenic
1173950665 20:46990770-46990792 ACAGCAGCAAATCCCAAAGCTGG - Intronic
1175060758 20:56240271-56240293 ACAGCATAAAATTCTGAAGTAGG + Intergenic
1175425727 20:58864746-58864768 ACAGCGTAAAAGTAAAAAGCTGG - Intronic
1181525121 22:23478855-23478877 AAATCATTAAAACCTAAAGCTGG + Intergenic
1184614919 22:45631500-45631522 ATTGCATAAAAGCCTACACCAGG + Intergenic
950941725 3:16899325-16899347 ACAGCAGAAAAGCCTAAGGCTGG - Intronic
952505943 3:34006965-34006987 ATAACACAAAACCCTAAAGCAGG - Intergenic
955786426 3:62545111-62545133 ACATCATAGAACCCCAAAGCTGG - Intronic
959670286 3:108969814-108969836 AAAGCATCAAAGCCTAGAACTGG + Intronic
960428061 3:117533493-117533515 ACAGCAAAAAAGTCAAATGCAGG - Intergenic
960818158 3:121695431-121695453 ACAGCAGAAAATCCTAGAGCTGG - Exonic
960961375 3:123072740-123072762 ACAGAATAAAACCACAAAGCTGG - Intronic
961861638 3:129921117-129921139 GCAGAATAAAACCCAAAAGCTGG - Intergenic
964595834 3:158426856-158426878 TCATCAAAAAAGCTTAAAGCCGG - Intronic
964919907 3:161884131-161884153 ACACCATATATGGCTAAAGCAGG - Intergenic
968723965 4:2231155-2231177 ACAGCCTAAAGGTCTATAGCAGG + Exonic
970197725 4:13569078-13569100 ACAACATAAAATCCTGAAACTGG + Exonic
970955826 4:21810270-21810292 ATAGCATAAAATCATAAAACTGG + Intronic
971626966 4:28933657-28933679 ACAGCATAAAGGCTTTAAGACGG + Intergenic
974855026 4:67451303-67451325 ACAGCATAAAAGATTAAAAATGG + Intergenic
977065658 4:92311311-92311333 AAAGCATAAAAACCTGAAGCAGG - Intronic
978174985 4:105718932-105718954 ACAACATAAAAGCCTAGCCCAGG + Intronic
980485709 4:133455460-133455482 ACAGCAGAATATCCTAAAGGAGG - Intergenic
980568618 4:134580044-134580066 AGATCATAAAAGCCTCCAGCTGG - Intergenic
983168068 4:164502131-164502153 AAAGAATCAAAGCCAAAAGCTGG - Intergenic
984692120 4:182738700-182738722 AGATTATAAAAGCCTAAAGTGGG + Intronic
986802611 5:11277829-11277851 ACAGCATAAAAGCCTAAAGCAGG - Intronic
988639520 5:33025996-33026018 ACAACATTAAATCTTAAAGCTGG + Intergenic
988869878 5:35377446-35377468 ATTGCATAAAACCATAAAGCAGG - Intergenic
991668501 5:69023699-69023721 ACACCATAAAAAACCAAAGCTGG - Intergenic
992936373 5:81711109-81711131 AGGGTATAAAAGCCTAAAGTAGG + Intronic
993044497 5:82852287-82852309 ACAGCAGCACAGCCTAAACCAGG + Intergenic
995364312 5:111338903-111338925 AAAGCAAAAAAGAATAAAGCCGG - Intronic
996731962 5:126725332-126725354 AGCACATAAAAGCCTAAAGATGG - Intergenic
1000105590 5:158055990-158056012 ACACCATAAAATATTAAAGCAGG + Intergenic
1000539727 5:162525400-162525422 ACAGCATAAGAATGTAAAGCAGG + Intergenic
1004996431 6:21198341-21198363 AACGCCCAAAAGCCTAAAGCTGG - Intronic
1006426220 6:33964550-33964572 ACACCATAATATCCAAAAGCAGG - Intergenic
1006640602 6:35487764-35487786 ACAACAAAAAACACTAAAGCAGG + Intronic
1008733416 6:54511714-54511736 ACAGCTTAAAAGCATACACCGGG + Intergenic
1012180886 6:96151193-96151215 AAAGAATTAAAGCCTCAAGCAGG - Intronic
1014698209 6:124651105-124651127 ACAACATTAAATCTTAAAGCTGG + Intronic
1015193774 6:130502312-130502334 ACAGCAGAGAGGCCTAAAGATGG + Intergenic
1015555597 6:134458585-134458607 ACTGCGTAAAGGCCTGAAGCAGG - Intergenic
1017532558 6:155310940-155310962 TTAGCATAAATGCTTAAAGCAGG + Intronic
1020399574 7:7760124-7760146 ACAGCATGATGGCCTCAAGCTGG - Intronic
1021546059 7:21814160-21814182 ATAGCATAAAAGACTAAAATTGG + Intronic
1022815464 7:33909830-33909852 ACAGCTTAAAAGTTTAAATCAGG - Intronic
1027420699 7:78015058-78015080 ACTTCATAAAAGCTTAAATCTGG - Intergenic
1028239017 7:88397096-88397118 ACATTATAAAAGCCTAGAGATGG + Intergenic
1028591999 7:92507148-92507170 ACATGATAAAAGACTGAAGCAGG + Intronic
1030026791 7:105332043-105332065 GCAGCACAAAGGCCCAAAGCAGG + Intronic
1030176256 7:106658775-106658797 ACACTATAAAAGCGTAAAGAAGG + Exonic
1032454265 7:132060208-132060230 AGACCATAACAGCCTAAAGAGGG + Intergenic
1035086989 7:156268756-156268778 ACAGAAGAAAAGCCAAAAGCAGG + Intergenic
1037638427 8:20721124-20721146 ACAGAACAAAAGCAGAAAGCAGG + Intergenic
1037638834 8:20724342-20724364 AGGTCATAAAAACCTAAAGCAGG + Intergenic
1037868790 8:22471637-22471659 ACAGTATAAAAGGCAAAAACTGG + Intronic
1039783091 8:40806961-40806983 ATAGCATAAGATCCTAAAGGTGG - Intronic
1040837679 8:51749515-51749537 ACAGCATAAAAGATTAAAAACGG + Intronic
1041377232 8:57216814-57216836 ACAGCAGAAAACCCTTAAGCAGG + Intergenic
1044496832 8:92896675-92896697 ACAACATTAAATCTTAAAGCTGG - Intronic
1045713358 8:105012200-105012222 AAAGCATAAAGGACTAAAACAGG - Intronic
1045990862 8:108305868-108305890 ACAGCATAATAGTTAAAAGCAGG - Intronic
1046912057 8:119639196-119639218 AAACCTTAAAAGCTTAAAGCTGG - Intronic
1048942108 8:139409094-139409116 ACAACCTAAAAGCCAAAACCAGG - Intergenic
1049049364 8:140182079-140182101 TCAGCATACAAGCCTAGTGCTGG + Intronic
1051074229 9:13210981-13211003 ACACCATAAAAGCCAAAATAAGG + Intronic
1052276794 9:26685844-26685866 CAAGAATAAAAGCCAAAAGCAGG + Intergenic
1052370011 9:27653969-27653991 AAAGCAAAACATCCTAAAGCTGG - Intergenic
1052832612 9:33228498-33228520 ACAGCAGAAGACCCTAAGGCTGG + Intronic
1053218255 9:36290546-36290568 ACAGGATAAAAGCTTCAATCAGG + Intronic
1054734404 9:68735913-68735935 ACAGTGCAAAAGCCTGAAGCAGG + Intronic
1055718743 9:79147831-79147853 ACAGCATAAAATCCTAAGCATGG + Intergenic
1055914661 9:81388886-81388908 ACAGGACAAGAGCCTTAAGCAGG + Intergenic
1056252621 9:84765583-84765605 ACAGCAGAAAACACTGAAGCTGG - Intronic
1059712922 9:116886101-116886123 GCAGCAAAAAAGCCTAGTGCTGG + Intronic
1059792018 9:117650338-117650360 ACAGGAGAAAACCCCAAAGCGGG + Intergenic
1186198489 X:7132954-7132976 AAAGCCTGAAAGCCTGAAGCAGG + Intronic
1188549244 X:31344263-31344285 ACAGGATAAATGCCTAAAGGTGG - Intronic
1190458270 X:50645857-50645879 GCAGCAGAAAAGCCAGAAGCTGG + Intronic
1191839498 X:65501553-65501575 GCAGCATAAAAGCTAAGAGCTGG - Intronic
1195426252 X:104734888-104734910 CCAGGATAAAAGCATAAAGTGGG - Intronic
1196960750 X:120998036-120998058 ACTGTAAAAAAGCCTCAAGCAGG - Intergenic
1199577982 X:149333224-149333246 CCAACAGAAAAGCTTAAAGCAGG + Intergenic
1200761931 Y:7046756-7046778 AAAGGATAAAGGCCTAATGCAGG - Intronic