ID: 986803631

View in Genome Browser
Species Human (GRCh38)
Location 5:11286858-11286880
Sequence CTGTTCTTGTGCATGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986803631_986803633 9 Left 986803631 5:11286858-11286880 CCAGGACACATGCACAAGAACAG 0: 1
1: 0
2: 0
3: 18
4: 245
Right 986803633 5:11286890-11286912 GCTGTCTACCAATAAGAGCATGG 0: 1
1: 0
2: 0
3: 9
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986803631 Original CRISPR CTGTTCTTGTGCATGTGTCC TGG (reversed) Intronic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
900520875 1:3104986-3105008 CTGTTCTGGAGCAGGTGTCATGG + Intronic
901063055 1:6482259-6482281 CTGTCCTTGCGAATGTGACCAGG - Intronic
901831575 1:11895493-11895515 CTGTTATTCTGCCTGTGCCCGGG - Intergenic
903351643 1:22720463-22720485 CTGTTGTTGTCCATGTTTCTTGG + Intronic
904019821 1:27454929-27454951 ATGTTTTTGTACATGTCTCCTGG + Intronic
904043326 1:27596461-27596483 CTGTCCTTGTGCATCTGTGTGGG + Intronic
904297956 1:29534579-29534601 ATGTTCTTGTGCTTTTGTTCTGG - Intergenic
906746689 1:48226734-48226756 CTGATCTTGTTGATGTCTCCTGG + Intronic
907514352 1:54983905-54983927 CTCTTCCTGTGAATCTGTCCAGG - Intronic
907659581 1:56379518-56379540 CTGTTGTTCAGCAAGTGTCCAGG + Intergenic
910081506 1:83347770-83347792 CTGTCCTTGTGCTCATGTCCAGG - Intergenic
911186294 1:94908325-94908347 ATGTTCCTGTGCCTGGGTCCAGG + Intronic
911876360 1:103168683-103168705 ATATTCTTGTACATGTCTCCTGG + Intergenic
912786982 1:112613919-112613941 CAGATCTTGTTCATTTGTCCAGG + Intronic
915008539 1:152663407-152663429 CTGTGCTTTTGCATGTGACCAGG + Exonic
915010268 1:152678989-152679011 CAGGTCTTGTGCCTGTCTCCAGG - Intergenic
915038941 1:152951630-152951652 CCCTTCTTTTGCATGTGACCTGG + Intergenic
915674653 1:157518884-157518906 ATGTACTTGTTCATGTTTCCAGG - Intronic
916284308 1:163088164-163088186 ATTTTCTTTTGCATGTATCCAGG + Intergenic
916388859 1:164307993-164308015 CTTCTCTTGGGCATGTGTTCAGG - Intergenic
918839753 1:189519016-189519038 CAGGTCTTGTACATGTATCCTGG + Intergenic
919180263 1:194071277-194071299 GTGTTCTTGTACATATGCCCAGG - Intergenic
920339539 1:205267360-205267382 CAGTTCTGGTGCATGTGACTGGG + Intronic
921036118 1:211380134-211380156 ATTTTCTTGTACATGTTTCCTGG - Intergenic
921659761 1:217787781-217787803 CCTTTCTTGTGTATCTGTCCAGG + Intronic
922365916 1:224863574-224863596 TTGTTCATGTGCACGTGTTCAGG + Intergenic
923225045 1:231931357-231931379 CTGTTCTGGTGCATTTGTGTTGG + Intronic
1065976769 10:30848570-30848592 CTGTTCTTTGGTATGTCTCCTGG + Exonic
1067664189 10:48259795-48259817 CTGTTCTTATGCAGGAGTCCTGG - Intronic
1068414778 10:56705899-56705921 CTATTCTTGTGCATGTATATTGG + Intergenic
1068470521 10:57456719-57456741 TTGTTCTTTTCCATGTCTCCTGG - Intergenic
1069713911 10:70508629-70508651 CTGTTCTTGTGACTGTGGGCAGG + Intronic
1070534099 10:77362287-77362309 CTCTTCTTAAGGATGTGTCCTGG - Intronic
1070549130 10:77476673-77476695 CTGCTCAGGTGCATGTGCCCAGG + Intronic
1071459013 10:85874084-85874106 ATTGTCTTGTGCATGTGTCTTGG + Intronic
1072214373 10:93275739-93275761 CTGTTCTTGTTCCTGTGGCATGG + Intergenic
1075275047 10:121085687-121085709 CTCTACTGGTGCCTGTGTCCTGG + Intergenic
1077631177 11:3812029-3812051 ATGTACGTGTGTATGTGTCCTGG + Intronic
1078037866 11:7826363-7826385 CTGTTCTTTTCCATGAGTCTTGG - Intergenic
1078593908 11:12670603-12670625 ATATTCTTGCACATGTGTCCTGG + Intergenic
1078677190 11:13433065-13433087 ATGTTTTTGTCCATGTTTCCTGG + Intronic
1078680991 11:13475606-13475628 CCATTCTTGTGCATGTGTATTGG - Intergenic
1078990452 11:16641290-16641312 CTGTTCTTTTGCATTTGCCGAGG + Intronic
1079691133 11:23418432-23418454 GTGTGCATGTGAATGTGTCCTGG - Intergenic
1081755566 11:45541918-45541940 CTGATTGTGTGCATGTGTGCAGG - Intergenic
1088626118 11:111731932-111731954 CTGTTATTTTGCCTGCGTCCTGG - Intronic
1090256506 11:125288138-125288160 CTGTTCCTGGGCATGTGGCCTGG - Intronic
1090638504 11:128709470-128709492 CTGTACTTGTGCATTTGTAGGGG - Intronic
1090792752 11:130106013-130106035 CTTTTCTCGTGCATGTCTGCAGG + Intronic
1091167199 11:133490173-133490195 CTTTTCTCTTGCATGCGTCCTGG - Intronic
1091849629 12:3684850-3684872 CTTTCTTTGGGCATGTGTCCTGG - Intronic
1091992049 12:4963379-4963401 CTGGTCATGAGGATGTGTCCTGG - Intergenic
1093599598 12:21005442-21005464 CTGTTCTTTTGCATTTGCCGAGG - Intergenic
1093934665 12:24987940-24987962 CTGTCCTTGAGCATGAGTCAGGG - Intergenic
1093963059 12:25296500-25296522 ACTTTCTTGTGCATGTGTCTTGG + Intergenic
1094259416 12:28476233-28476255 CTGTTCTTTTGCATTTGCCGAGG - Intronic
1095233126 12:39765746-39765768 CACATCCTGTGCATGTGTCCTGG - Intronic
1095578650 12:43769328-43769350 TTGTTCTCGTGCATGTGAGCAGG + Intronic
1097412377 12:59270657-59270679 CTGTTCTTTTGCATTTTTCTGGG - Intergenic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1100446480 12:94665039-94665061 ATGTTCTTGTACGTGTGTCCTGG - Intergenic
1101487355 12:105178657-105178679 CTGATCTTGTGCAAGTCACCCGG + Intronic
1101487729 12:105182637-105182659 CTGTTCTTTTGCATTTGTTGAGG + Intronic
1102606040 12:114067931-114067953 ATGTTTTTGGGCATGTCTCCTGG + Intergenic
1103588715 12:121975229-121975251 CTGTTGTTGTTCCAGTGTCCTGG + Exonic
1104174299 12:126314844-126314866 CTCTTCTTGTTCATTTGTGCAGG + Intergenic
1104489676 12:129183142-129183164 CTGGTCTTGGCCATGTGGCCTGG - Intronic
1104810649 12:131618177-131618199 CTGTTCATGGACATGTGGCCTGG + Intergenic
1107215638 13:37915121-37915143 CTCTTAATGTGCATGTGTCAGGG + Intergenic
1107832916 13:44390311-44390333 CTGTCCTGGAGCAAGTGTCCAGG - Intronic
1108462160 13:50677454-50677476 CTGTACTTGTGCATGTGAAATGG + Intronic
1109799164 13:67352598-67352620 ATGTTCTTTTCCATGTTTCCTGG + Intergenic
1110365649 13:74682060-74682082 CAGTTCTTGTGCATGGGTATTGG - Intergenic
1111080890 13:83305902-83305924 CTGTTCTTTTGCATGTGCTGAGG + Intergenic
1111965984 13:94862344-94862366 GTGTTCTCGTGCATCTGTGCTGG + Intergenic
1113613808 13:111666491-111666513 GTGTGCATGTGCATGTGTGCAGG + Intronic
1115276790 14:31618656-31618678 CTGTTCTTTTGCATTTGTTGAGG + Intronic
1116088951 14:40279103-40279125 CTGTTCTGGTGGATGTGGCAGGG + Intergenic
1117147672 14:52851472-52851494 ATATTCTTGTGCTTGTCTCCCGG + Intergenic
1117640084 14:57788775-57788797 CCGTTCTTTTGCATTTGTCGAGG - Intronic
1117853444 14:60001280-60001302 ATATTCTTGTGCATGTTTCCTGG - Intronic
1118382072 14:65225593-65225615 CTGTTCTTTTTCATCTGCCCGGG + Intergenic
1119321880 14:73736998-73737020 CTGAGCTTGAGCATCTGTCCCGG + Exonic
1121965831 14:98304777-98304799 ACATTCTTGTGCATGTGTCCTGG - Intergenic
1122864124 14:104595859-104595881 CTGCTCCTGTCAATGTGTCCTGG - Intronic
1123148882 14:106161926-106161948 CTGTTCTTTTGCATTTGGCGAGG - Intergenic
1125419753 15:39492779-39492801 CTGTTCTAGTCCATGGGGCCAGG + Intergenic
1125589233 15:40844257-40844279 CTGCGCTCGTGCGTGTGTCCGGG + Intronic
1127269039 15:57384270-57384292 CTGATCTTGGGCAGGTCTCCTGG - Intronic
1129135629 15:73547849-73547871 CTTTGCCTGTGCCTGTGTCCTGG - Intronic
1131225425 15:90621029-90621051 CTTTTGTTGGGCATGCGTCCTGG - Intronic
1132622520 16:874534-874556 CTGCTCTTGTGCACCTCTCCAGG + Intronic
1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG + Exonic
1134107856 16:11496724-11496746 GTGTGCCTATGCATGTGTCCAGG + Intronic
1136268225 16:29133064-29133086 CTGCGCTTCTGCAGGTGTCCTGG + Intergenic
1136681343 16:31965655-31965677 CTGTTCTTTTGCATTTGGCGAGG + Intergenic
1136781650 16:32907167-32907189 CTGTTCTTTTGCATTTGGCGAGG + Intergenic
1136888141 16:33946688-33946710 CTGTTCTTTTGCATTTGGCGAGG - Intergenic
1140676537 16:77337812-77337834 CTATTCATGTGAATGTGTGCAGG - Intronic
1142071536 16:88093402-88093424 CTGCGCTTCTGCAGGTGTCCTGG + Intronic
1203084308 16_KI270728v1_random:1171149-1171171 CTGTTCTTTTGCATTTGGCGAGG + Intergenic
1142753017 17:1999625-1999647 GTGTATTTGTGCATGTGTGCAGG - Intronic
1142804718 17:2365320-2365342 CTGTGCTCGTGCCTGTGGCCGGG - Exonic
1143207243 17:5152491-5152513 ATATTCTTGTGCATCTCTCCTGG - Intronic
1144062394 17:11595188-11595210 ATGTTCTTATGCATGTCTCCTGG + Intergenic
1144080563 17:11760366-11760388 CTTTGTTTGTGCATGTGTGCCGG + Intronic
1146156644 17:30529995-30530017 CTCTTCTTGCCCAAGTGTCCAGG - Intergenic
1149188108 17:54026176-54026198 CAGATCTTGTGCATTTGTCATGG + Intergenic
1150901082 17:69278066-69278088 ATGTTCTTGTACATGTGTTTTGG - Intronic
1151360997 17:73588794-73588816 CTGTGCTTGTGCATTGGCCCTGG - Intronic
1152316946 17:79586438-79586460 TTGTTCTTGCTCATGAGTCCAGG - Intergenic
1152800815 17:82329900-82329922 CTGAGCTGGGGCATGTGTCCTGG - Intronic
1154180171 18:12129990-12130012 CTGTACTTTTGCATGTGGTCTGG - Intergenic
1155061582 18:22233472-22233494 GTGTTCGTGTGCCTGTGTCAAGG + Intergenic
1156383599 18:36586083-36586105 CTGTTCATTTTCATGTTTCCAGG + Intronic
1157733793 18:50028563-50028585 CTCTTCCTGTGCAGCTGTCCAGG - Intronic
1158829810 18:61264418-61264440 CTGTTCTGGGGGATGTGGCCGGG - Intergenic
1160226487 18:77015898-77015920 CTGTTTTTCTGCCTGTGTGCAGG - Exonic
1165015816 19:32879284-32879306 CTGTCCTCGTGAGTGTGTCCTGG + Exonic
1166580639 19:43895573-43895595 CTATTCTGGTGCATGTGTAGTGG + Intronic
1168014282 19:53558770-53558792 ATGTTCTTGTCCATGGTTCCTGG - Intronic
925484239 2:4310746-4310768 CTGTTCTTTTGCATTTGTTGAGG + Intergenic
925538283 2:4939500-4939522 CTGTTTTAGGGCATGTGTCTGGG - Intergenic
926283485 2:11469034-11469056 CTGTTTTTGTGTATGCTTCCTGG + Intergenic
926819394 2:16836006-16836028 TTTTTTTTGTGCATGTGCCCTGG + Intergenic
929948517 2:46388721-46388743 CTGTTCTTCTGCAGGCCTCCTGG - Intergenic
930357163 2:50335635-50335657 CAGTTCTGCTGCAGGTGTCCTGG + Intronic
930359603 2:50360873-50360895 CTGTTCTTTTGCATTTGCCGAGG - Intronic
930364867 2:50426725-50426747 CTGTTCTTTGGCATGGGTCAGGG - Intronic
931897690 2:66751214-66751236 TTATTCTTGTTCATGTCTCCTGG + Intergenic
934733593 2:96675237-96675259 ACATTCTTGTGCATGTCTCCTGG + Intergenic
940031239 2:149264233-149264255 CTGTTCTTTTGCATTTCTCTAGG + Intergenic
940531679 2:154886152-154886174 CTCTTACTGTGCATGTGTACAGG + Intergenic
945389270 2:209244178-209244200 CTGTTCTTTTGCATTTGTTGAGG - Intergenic
945401559 2:209388617-209388639 ATGTTCTTGTCCATCTGTTCTGG + Intergenic
945845663 2:214941333-214941355 CTGTTCTTTTGCATTTGTTAAGG + Intronic
947102844 2:226639823-226639845 ATGTCCTTGTGTGTGTGTCCTGG - Intergenic
948941074 2:241196881-241196903 GTGTCCTTGTGCCTGTGTGCAGG + Intronic
1169895083 20:10496171-10496193 CAGTGCTTATGCATGTGTCTGGG + Intronic
1171320870 20:24242969-24242991 CTGTGCATGTGCATGTATGCAGG - Intergenic
1171862159 20:30411245-30411267 TTGTTCTTCTCCCTGTGTCCAGG - Intergenic
1173037123 20:39422962-39422984 ATGATCTTGTGTATGTGTCTGGG + Intergenic
1173941025 20:46911396-46911418 CTGTTCTTCTGCATGGCACCCGG + Intronic
1174989636 20:55495860-55495882 CTGTTCTTTTGCATTTGCCGAGG + Intergenic
1178062558 21:28868236-28868258 CTGTTCTTGGTCATTTGTTCCGG + Intergenic
1178125766 21:29514072-29514094 CCCTTATTGTGCATGTGTCAGGG - Intronic
1181079416 22:20404030-20404052 CTGCTCTTCTGCATGTGTTGGGG + Intronic
1181291442 22:21797038-21797060 CTGTTGGTGTGCCTTTGTCCTGG - Intronic
1181735538 22:24878550-24878572 CTGTTTTTCTGGATGTCTCCTGG + Intronic
1183362807 22:37391422-37391444 CTGTTCCTGGGCCTGTGTCATGG - Intronic
949109047 3:236421-236443 GTGTTCTTGAGAATGTGTCTTGG + Intronic
949706246 3:6820730-6820752 CTGTGCTTGTGTGTGTGTCTTGG - Intronic
950582583 3:13872103-13872125 CTGTTCCAGTGTGTGTGTCCAGG - Intronic
950637895 3:14328737-14328759 TTGTGCTTGTGCATGTCTTCTGG + Intergenic
951713943 3:25618418-25618440 CTTTTCTTGTGCTTCTTTCCAGG + Exonic
951744780 3:25965868-25965890 TTGTTCTAGTGCCTGGGTCCAGG - Intergenic
955759434 3:62262852-62262874 CTGTTTTTGTGCTTGTTTTCTGG - Exonic
957017295 3:75082762-75082784 AGGTTCTTGTGCATGTTTTCTGG - Intergenic
958081355 3:88749659-88749681 CTGTTCTTTTGCATTTGTTGAGG - Intergenic
960697254 3:120408185-120408207 CTGTTCCTGTCCAAGTCTCCTGG + Intronic
960920483 3:122742054-122742076 ATATTCTTGTACATGTTTCCTGG - Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
964232759 3:154489531-154489553 CTGTTCTTTTGCATTTGTTGAGG - Intergenic
966728801 3:183133180-183133202 CATTTCTTGGGCATGTGTCTGGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967257471 3:187608719-187608741 CTGTTCTGGTGCAGGTGGCAGGG + Intergenic
968818266 4:2832833-2832855 CTGTCCTTGTGCAGGTGGTCTGG + Intronic
970463304 4:16297355-16297377 CTTTTCTTGTGCCTGGGTCTTGG - Intergenic
971207684 4:24585677-24585699 CTTTTCTTGTGCATTTCTTCTGG - Intergenic
971797528 4:31247671-31247693 CTTATTATGTGCATGTGTCCAGG - Intergenic
972257216 4:37369997-37370019 CTGTTCTTTAGCATCTGTGCGGG + Intronic
974570109 4:63634732-63634754 CTTTTCCTGTTCATATGTCCAGG - Intergenic
975758021 4:77590538-77590560 CTGTTCTTGAGCGTTTTTCCAGG - Intronic
978027440 4:103895502-103895524 CTTTGCTTGTTCTTGTGTCCAGG - Intergenic
979043944 4:115837001-115837023 CTGTTCTTTTGCATTTGCTCAGG - Intergenic
979512497 4:121570055-121570077 CTGTTCTTTTGCATTTGTTGAGG - Intergenic
980422348 4:132580093-132580115 ATGTTCTGATGCTTGTGTCCAGG + Intergenic
981296940 4:143143130-143143152 CTGTTCTTTTGCATTTGCCGAGG - Intergenic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
983867398 4:172784989-172785011 CTGTCCTTGTGGAGATGTCCTGG - Intronic
984781984 4:183534240-183534262 CTGCTGTTGTCCATGTTTCCAGG + Intergenic
986109208 5:4694293-4694315 GCATTCTTGTGCCTGTGTCCTGG - Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
989679280 5:44010188-44010210 CTGTTCTTGTGGATGTGTAGCGG + Intergenic
989734356 5:44685646-44685668 CTGCTCTTGTGCTTGGATCCTGG + Intergenic
990081036 5:51913843-51913865 CTGTTCTTGTCAAAGTGGCCTGG + Intergenic
993348177 5:86811917-86811939 CTGTTCTTCTGCATGTATGGTGG - Intergenic
993528035 5:88990802-88990824 CTGTTCTTTTACATTTGTTCAGG + Intergenic
994075899 5:95649451-95649473 CTATTCTTGTGTATGTTTCCTGG + Intronic
994208162 5:97059303-97059325 CTGCTCTGGTGGATGTGTCAAGG + Intergenic
996104748 5:119486719-119486741 TTATTCTTGTACATGTGTTCTGG + Intronic
996536769 5:124585661-124585683 CTGTTCGTCTGCTTGTCTCCTGG + Intergenic
1000192748 5:158927381-158927403 TTGTTCTTCTTCTTGTGTCCCGG + Intronic
1000653920 5:163853050-163853072 CTGTTCTTTTGCATTTGCCAAGG + Intergenic
1001669342 5:173460940-173460962 ATTTTCTTGTTCATGGGTCCAGG + Intergenic
1002095880 5:176830540-176830562 GTGTGCATGTGCATGTGTCCTGG + Intronic
1003254818 6:4465731-4465753 CTGTTCTTCAGCCTGTGCCCAGG + Intergenic
1003326853 6:5098577-5098599 ATATTCTTGTGCGTGTCTCCTGG - Intergenic
1003332547 6:5142005-5142027 CTGTTTCTGTGCATGTGTCGGGG + Intronic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1003690794 6:8351957-8351979 CTCTTCTTGTCCCTGTGTCCTGG - Intergenic
1004175171 6:13333556-13333578 GAGTTCCTGTGCATGTGTACAGG - Intergenic
1006704099 6:36002335-36002357 ATATTCTTGTACATGTCTCCTGG + Intronic
1009878163 6:69532297-69532319 GTGTTCATGTGTATGTGTCTTGG + Intergenic
1012220270 6:96640402-96640424 CTGTTCTTTTGCATTTGTGGAGG - Intergenic
1012396017 6:98798197-98798219 ATGTTCTTGTACATGTCTCCTGG - Intergenic
1013233660 6:108177513-108177535 TTGTGCGTGTGCATGTGCCCAGG - Intronic
1013957439 6:115856728-115856750 CTGTTCTTTTGCATTTGTTGAGG - Intergenic
1014107725 6:117585758-117585780 CTGTCTTTGTGCATGTGTATGGG - Intronic
1015814282 6:137192133-137192155 CTGTTCCTGTGCACCTTTCCAGG - Intergenic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017881588 6:158566150-158566172 CTGGTCCTGTGCCTGTGGCCTGG - Intronic
1017982813 6:159417092-159417114 CTGTGGTTGTGCATGTGCGCAGG - Intergenic
1019364414 7:625023-625045 CTGTTCTTTTACATTTGTTCAGG - Intronic
1023162587 7:37311673-37311695 CTGTGGGTGTGCATGTGTCACGG - Intronic
1023511346 7:40956999-40957021 CTGTTCTTTTGCATTTGTTAAGG + Intergenic
1023925979 7:44670073-44670095 CTGTTCTTGGCCCTGTCTCCAGG - Intronic
1024216955 7:47256036-47256058 AGGTTCTGGTGCATCTGTCCGGG - Intergenic
1027174023 7:75892031-75892053 CTGTCCTTGTGCAGATGTCCAGG - Intergenic
1030500539 7:110354157-110354179 CTGTTCTTTTGCATTTGTTGAGG + Intergenic
1032698689 7:134359842-134359864 CTCTTTGTGTGCATGTGTACAGG - Intergenic
1034577842 7:152016608-152016630 GTTTTCTTGTTCATGTGTCCTGG - Intronic
1035578084 8:721048-721070 CTGTTTTTGTGCCTGTTTACAGG - Intronic
1037277352 8:17194840-17194862 TTTTTCTTGTACATGTCTCCTGG + Intronic
1038036877 8:23693733-23693755 ATATTCTTGTGCATGTCTTCTGG - Intergenic
1041120777 8:54584382-54584404 CTGTTCTTTTGCATTTGCTCAGG + Intergenic
1044263224 8:90152486-90152508 CTGTTCTTGTGGGTGTGTAGTGG + Intergenic
1044939985 8:97332524-97332546 CTGTTCTTTTGCATGTGCTAAGG + Intergenic
1045557286 8:103226556-103226578 CTATTCTTGTGATTGTGTGCTGG - Intronic
1046786742 8:118274915-118274937 ATATTCTTGTGCATGTCTCCTGG + Intronic
1047708078 8:127522760-127522782 CTGTTCTTGTGCTTGTCTGTAGG - Intergenic
1048236522 8:132696167-132696189 CTTTTCATGTGCATTTTTCCTGG - Intronic
1048456202 8:134580415-134580437 CTGTGCTTGTGCAGGTGCCTTGG - Intronic
1048723093 8:137349844-137349866 CTTTTCCTGTTCCTGTGTCCAGG + Intergenic
1049520762 8:143088983-143089005 GTGTCCATTTGCATGTGTCCTGG - Intergenic
1051565253 9:18490122-18490144 CTGTTTTACTGCATGTGTCCTGG + Intronic
1051615433 9:19001200-19001222 CTGTTCTTTTACATTTGCCCAGG - Intronic
1051850292 9:21498777-21498799 CTGTTCTTTTCCTTGTGTCATGG - Intergenic
1054814019 9:69457228-69457250 CTGTTCTGGTGACTGTGTCGTGG - Intronic
1056057711 9:82845024-82845046 CTGTTCCCCTCCATGTGTCCAGG + Intergenic
1056377684 9:86030268-86030290 ATGTTCTTGAGCATGTTTCACGG - Intronic
1056953503 9:91064599-91064621 GTGTTCTTGAGCATTTATCCCGG + Intergenic
1058305570 9:103436971-103436993 CTGTTCTTTTGCATTTGCTCAGG + Intergenic
1060319006 9:122538023-122538045 CTCTTACTGTGCATGTGTCGGGG + Intergenic
1062521144 9:136958515-136958537 CTCTGCTTGTGCCTTTGTCCGGG - Intergenic
1188897680 X:35688758-35688780 CAGTTCTTTTGCATTTGTCTAGG + Intergenic
1188897682 X:35688829-35688851 CAGTTCTTTTGCATTTGTCTAGG + Intergenic
1189553491 X:42117454-42117476 ATCTTCTTGTCCATGTGTACAGG + Intergenic
1191193028 X:57687009-57687031 CTGTTCTTTTGCATTTGTTGAGG - Intergenic
1193326733 X:80186767-80186789 CTGTTCTTGTGTTAGTGTGCTGG + Intergenic
1194218000 X:91154845-91154867 CTGTTATTATGCATTTGTCTAGG - Intergenic
1195392320 X:104375516-104375538 AAGTTCTTGCGCATGTGCCCAGG + Intergenic
1195424322 X:104711353-104711375 CTCTTTGTGTGCATGTGTACAGG + Intronic
1195802128 X:108724555-108724577 CTGTTCTTTGGAATGTGCCCCGG - Intronic
1196600153 X:117592233-117592255 CTGTTCTTTTGCATTTGCTCAGG - Intergenic
1196820445 X:119696412-119696434 CTGTTCTTGGGAAGGTGACCCGG - Intergenic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1198062882 X:133064489-133064511 CTGTTCTTTTGCATTTGTTGTGG - Intronic
1199137365 X:144268467-144268489 CAGTTCTTGTGCATTTGCTCAGG - Intergenic
1199744906 X:150766389-150766411 CTGTTCACGTGCTTGTGTCCAGG - Exonic
1200336518 X:155356461-155356483 CAGTTCTTTTGCATTTGTCGAGG - Intergenic
1200349952 X:155484766-155484788 CAGTTCTTTTGCATTTGTCGAGG + Intergenic
1200554505 Y:4618630-4618652 CTGTTATTATGCATTTGTCTAGG - Intergenic