ID: 986805126

View in Genome Browser
Species Human (GRCh38)
Location 5:11301966-11301988
Sequence GTGGGTAAACTGGAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986805121_986805126 -7 Left 986805121 5:11301950-11301972 CCTTGAGGAAGAGGGAGTGGGTA 0: 1
1: 0
2: 3
3: 43
4: 316
Right 986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 391
986805115_986805126 20 Left 986805115 5:11301923-11301945 CCATGACTTTCTCGGACTGAGTT 0: 1
1: 0
2: 2
3: 6
4: 119
Right 986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG 0: 1
1: 0
2: 0
3: 35
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986805126 Original CRISPR GTGGGTAAACTGGAGGAGGG TGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900322521 1:2092203-2092225 GTAGGAAAACAGGGGGAGGGCGG - Intronic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
901200239 1:7462893-7462915 GTGGGCACACGGGTGGAGGGAGG - Intronic
902231105 1:15028200-15028222 GTGGGGACTCTGGAGGTGGGAGG - Intronic
902500067 1:16904890-16904912 GTGGGCTGAGTGGAGGAGGGTGG + Intronic
902620498 1:17647967-17647989 GTGGGTGAACTGGAGGCAGGCGG + Intronic
904198105 1:28801172-28801194 TTCTGTAAACTGAAGGAGGGTGG + Intergenic
904389336 1:30171522-30171544 GGAGGGAAACTGGAGGGGGGAGG - Intergenic
904625611 1:31800225-31800247 CAGGGTGGACTGGAGGAGGGAGG - Intronic
905508718 1:38501558-38501580 GAGGTCAAATTGGAGGAGGGTGG - Intergenic
906020270 1:42622068-42622090 GTGGGGAAATTGGGGGAGGTGGG - Intronic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
909115003 1:71522470-71522492 GTGGTTTAAGTGGAGGAGAGTGG + Intronic
910330462 1:86067276-86067298 GTGGGCAAAATGGAAGAGAGTGG + Intronic
911054888 1:93701076-93701098 GTGGGGAAACAGGAGCAGAGAGG - Intronic
911244864 1:95505640-95505662 GGGGGTTTACTTGAGGAGGGAGG - Intergenic
912680273 1:111725008-111725030 GTGGGGGAGCTGCAGGAGGGAGG - Exonic
912694756 1:111832892-111832914 GGTGGTGAGCTGGAGGAGGGAGG - Intronic
914872363 1:151485776-151485798 GTGGGTCAACTGCAGGGTGGAGG + Intergenic
914917578 1:151827953-151827975 GCGGGTGAGCTGGGGGAGGGGGG - Intronic
916100335 1:161388807-161388829 GTGAGGAAACTGCAGGAGGCTGG - Intergenic
916439656 1:164810745-164810767 AGAGGTAAACTGGAGGAGGAAGG - Intronic
916484805 1:165249351-165249373 GTGGGTAGAGTGGAGTTGGGTGG - Intronic
917074321 1:171188138-171188160 TTTGGTATACTGGGGGAGGGAGG - Intronic
917243579 1:172975776-172975798 GGGGGTAAACAAGAGGAGGGTGG - Intergenic
917598354 1:176552290-176552312 GAGGGTAAAATGGAAGGGGGAGG - Intronic
918072547 1:181143508-181143530 GTGGGGAAATTGGAGGACAGGGG + Intergenic
918881051 1:190121720-190121742 GTGGGGAAAGTGGAAAAGGGAGG + Intronic
921468374 1:215519609-215519631 GTGTCTAAACTGCAAGAGGGTGG - Intergenic
922205272 1:223441006-223441028 GAGGCTATACTGGAGTAGGGTGG - Intergenic
922222517 1:223619247-223619269 GAGGATAAGCTGGAGGAGGTTGG + Intronic
922556183 1:226534027-226534049 GTGGGAAGATGGGAGGAGGGGGG + Intergenic
923052075 1:230396114-230396136 GGGGGTAAAGGGGAGGAGAGTGG - Intronic
923052088 1:230396157-230396179 GTGGGTAAAAGGGAGGAGTGTGG - Intronic
923052108 1:230396234-230396256 GGGGGTAAAAGGGAGGAGTGTGG - Intronic
923052115 1:230396255-230396277 GGGGGTAAAAAGGAGGAGTGTGG - Intronic
923290290 1:232538685-232538707 GTGTGTATAGTGGGGGAGGGGGG - Intronic
923903199 1:238352527-238352549 GTGGGTAAACTGCAGGTAGCTGG + Intergenic
1063630931 10:7733135-7733157 GTGGTTACAGTGGAGGAGGGGGG - Intronic
1063646597 10:7889944-7889966 GAAGATAAACTAGAGGAGGGAGG - Intronic
1064724481 10:18264524-18264546 GTGGGTACCCTGGGGGAGGTGGG - Intronic
1065491203 10:26283591-26283613 GTGGTTTAACTAGAGGAGGGTGG - Intronic
1065506813 10:26438071-26438093 GTGGTTAAACGTGGGGAGGGAGG + Intergenic
1066363730 10:34756112-34756134 ATGGGGAGATTGGAGGAGGGAGG - Intronic
1068169920 10:53380001-53380023 GTGGGAAAAATGGAAAAGGGAGG - Intergenic
1068652996 10:59543102-59543124 GTGGTCATACTGGAGTAGGGTGG - Intergenic
1068827988 10:61461153-61461175 GTTGGGGAACTGGAGGAGAGTGG + Intergenic
1068842299 10:61629433-61629455 GTGGGTGAAGTGGTGGAGTGTGG - Intergenic
1069870461 10:71529805-71529827 GTGGGTAAGGAGGAGGTGGGAGG - Intronic
1070664929 10:78336195-78336217 GGGAGTAAGGTGGAGGAGGGAGG + Intergenic
1071490328 10:86131876-86131898 GTTGGTAAACAGATGGAGGGTGG - Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071802645 10:89080794-89080816 GTAGGTAGACTGGAGGTGGGGGG - Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072889127 10:99306271-99306293 GAGGGTAAAATGGAGGAGGAGGG - Intergenic
1073062797 10:100742336-100742358 GTGGGTACACTCGAGGTGCGGGG + Intronic
1074575371 10:114663879-114663901 GTGGGGAACCTGGAGCAGGCAGG - Intronic
1075274607 10:121081859-121081881 CTGGGGACACTGGAGGAGAGAGG + Intergenic
1075528340 10:123204484-123204506 GAGGGTAAATTGGATGAGGCGGG - Intergenic
1076182256 10:128419326-128419348 GTAGGTGAAATGGATGAGGGTGG + Intergenic
1076654066 10:132009848-132009870 GTGGGAAAACTGGAGGCAGCAGG - Intergenic
1076820944 10:132939310-132939332 GAGTGTGAAGTGGAGGAGGGTGG + Intronic
1078517776 11:12039327-12039349 GTTGGTAAAGGGGAGGAGGACGG + Intergenic
1080535901 11:33221355-33221377 GTGGGTAATTTTGAGGAGGAGGG + Intergenic
1082806279 11:57453601-57453623 GTGGGTAAAGTCTAGGATGGAGG - Intergenic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1085445405 11:76597823-76597845 GTGGGTACAGAGGAGGAGGTGGG - Intergenic
1085565780 11:77512247-77512269 GAGGGAAAACTGGAGGCAGGAGG - Intergenic
1087205117 11:95386363-95386385 GAGGATAGACTGGAGGAGGCTGG + Intergenic
1087287324 11:96278947-96278969 GTGGGTATAAAGGAGAAGGGAGG + Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088564587 11:111155371-111155393 GTGAGTATACTGGAGTAAGGTGG - Intergenic
1089051549 11:115550023-115550045 GAGGGAAAACTGGAGGTGGCTGG - Intergenic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089665516 11:120015682-120015704 GTGGGTAAACTTGGAGAGTGTGG - Intergenic
1089991950 11:122869826-122869848 GTGTGAAAACTGGGGGTGGGAGG + Intronic
1090796496 11:130140174-130140196 ATGGGTATAATGGAGGAGGAGGG - Intronic
1091305112 11:134531670-134531692 GTGGCTGCACTGGAGGTGGGGGG - Intergenic
1092988145 12:13866662-13866684 CTGGATAAACTGGATGTGGGGGG + Intronic
1094432478 12:30385066-30385088 GTTGGTAAGCTGGAAGAGGATGG + Intergenic
1094700820 12:32869099-32869121 GTTGGTAGGCAGGAGGAGGGAGG - Intronic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1098146816 12:67506020-67506042 GAGGGCACACTGGAGTAGGGTGG + Intergenic
1098315298 12:69186198-69186220 GTGGGACAACTGAAGCAGGGAGG - Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099712248 12:86242684-86242706 GAGGGAAAAATGGAGGAAGGGGG + Intronic
1100221774 12:92512291-92512313 GAAGGTAGACTGGAGGAGGAAGG - Intergenic
1101823366 12:108201396-108201418 GAGGCTAAACTGGAGTAGGCTGG - Intronic
1102138256 12:110593211-110593233 CTGACTAAACTGGAGGAGGGTGG + Intergenic
1102920618 12:116789068-116789090 ATGGGTAAATGGGAGGAGAGTGG + Intronic
1102920672 12:116789296-116789318 ATGGGTAAATGGGAGGAGAGTGG + Intronic
1102920710 12:116789470-116789492 ATGGGTAAATGGGAGGAGAGTGG + Intronic
1102920719 12:116789501-116789523 ATGGGTAAATGGGAGGAGAGTGG + Intronic
1102920776 12:116789745-116789767 ATGGGTAAATGGGAGGAGAGTGG + Intronic
1104448096 12:128848945-128848967 GTGGGGAAAATGGAGGGGGGTGG - Intergenic
1104615926 12:130268516-130268538 GTTGTTACACTGGAGGTGGGGGG + Intergenic
1104960969 12:132488641-132488663 CTGGGTGGACTGGAGGAGGCTGG + Intergenic
1105789880 13:23788003-23788025 GGGAGTCAGCTGGAGGAGGGTGG + Intronic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1106703367 13:32253914-32253936 GTGTGTAAACTGGAGCAGCCAGG - Intronic
1106983946 13:35322393-35322415 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
1107889660 13:44903271-44903293 GTTGGTAAAATGGAATAGGGGGG - Intergenic
1108060676 13:46529935-46529957 GTGGATATTCTGGAGGTGGGTGG - Intergenic
1108703263 13:52961775-52961797 GTGGATGAACTGGAGGGGAGAGG + Intergenic
1109202859 13:59450314-59450336 GTGGGTTCAGTGGAGGAGTGAGG - Intergenic
1110035835 13:70682344-70682366 GTGGGTAAAGTTGTGGATGGAGG - Intergenic
1110352605 13:74527007-74527029 GATGGTAGACTGGAGGAAGGTGG - Intergenic
1112441440 13:99427157-99427179 GAGGGTGAAAGGGAGGAGGGAGG + Intergenic
1112584586 13:100707065-100707087 GAGGCTATACTGGATGAGGGCGG - Intergenic
1113814108 13:113159737-113159759 GTCAGGAAAGTGGAGGAGGGAGG - Intronic
1114351600 14:21858482-21858504 GTGGGTTAAGTAGATGAGGGAGG + Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115957156 14:38794158-38794180 GTGGGGGAACTGGAGGAGGCTGG - Intergenic
1116126524 14:40795536-40795558 GTGGGTAAGAAGGAGGAGTGGGG + Intergenic
1117687988 14:58275040-58275062 GTGGTTAAACTGGGGTAGAGAGG - Intronic
1119712146 14:76829976-76829998 TTGGGCAAACTAGGGGAGGGGGG + Intronic
1121241891 14:92436873-92436895 GTGGGTAAAGGGGAGAAGGCAGG - Intronic
1121463297 14:94098447-94098469 GTGGTCATACTGGAGTAGGGTGG - Intronic
1121953690 14:98195157-98195179 GTGGGTAAACCTGAGCAGGGGGG - Intergenic
1123493539 15:20800609-20800631 GTGAGGATCCTGGAGGAGGGTGG - Intergenic
1123550047 15:21369711-21369733 GTGAGGATCCTGGAGGAGGGTGG - Intergenic
1124195173 15:27619293-27619315 GAGGGCAAACTGGAGTAGGGGGG - Intergenic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1124520455 15:30403956-30403978 GTGGGTAGGCAGGAAGAGGGGGG - Intronic
1124538202 15:30562263-30562285 GTGGGTAGGCAGGAAGAGGGGGG + Intronic
1124564627 15:30801753-30801775 GTGGGCAGGCTGGAAGAGGGGGG + Intergenic
1124641834 15:31400696-31400718 GTGTGGAAGGTGGAGGAGGGTGG + Intronic
1124760451 15:32445322-32445344 GTGGGTAGGCAGGAAGAGGGGGG - Intronic
1124778185 15:32603740-32603762 GTGGGTAGGCAGGAAGAGGGGGG + Intronic
1124826477 15:33101269-33101291 TTGAGTATACTGGAGGAGGTTGG + Intronic
1124964688 15:34424144-34424166 CTGGGCAAGCTGGAGGAGAGGGG - Intronic
1124981304 15:34570370-34570392 CTGGGCAAGCTGGAGGAGAGGGG - Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1127425328 15:58850213-58850235 GTGTGTACATGGGAGGAGGGAGG + Intronic
1127618803 15:60713316-60713338 GTGGGTAAAGTGGGGGTAGGAGG - Intronic
1127646280 15:60962574-60962596 TAGGGTAAAGTGGAGGAGAGCGG - Intronic
1127802707 15:62491432-62491454 GTGGGACAACTGGAAGTGGGTGG + Intronic
1128160247 15:65418826-65418848 GGGGGTTAAGTGGAGGAGGGTGG + Intronic
1129618386 15:77119555-77119577 GTTGGAAAACTGGGGGAGAGGGG + Intronic
1130108064 15:80943808-80943830 TTGGGGCAACTGGAAGAGGGAGG - Intronic
1130638955 15:85652908-85652930 GAGGTTATACTGGAGTAGGGTGG - Intronic
1131460021 15:92611219-92611241 GTGGGGAAAGGGGAGAAGGGAGG + Intergenic
1131545942 15:93315533-93315555 GTGGTCATACTGGAGTAGGGTGG - Intergenic
1202958377 15_KI270727v1_random:96929-96951 GTGAGGATCCTGGAGGAGGGTGG - Intergenic
1132818929 16:1851477-1851499 GAGGGTAAACTCCATGAGGGTGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1133569793 16:7030018-7030040 ATGGGAAAAGTGGAGGATGGTGG + Intronic
1134384214 16:13756906-13756928 AAGGGTAAACTTGAGGAGGGAGG - Intergenic
1136071722 16:27791510-27791532 GTGGGTAGACAGGATGTGGGTGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1139157183 16:64457744-64457766 GTGGGGAAACTGCAAGAAGGTGG - Intergenic
1139466088 16:67154971-67154993 GTGGGGAAACGGGGTGAGGGCGG + Intronic
1139480852 16:67229903-67229925 CTGGGTAAACTGGAGCCTGGGGG + Exonic
1140939985 16:79712527-79712549 ATGGGTACACTAGAGTAGGGAGG - Intergenic
1141672620 16:85500660-85500682 GGGGGTGAAATGGAGGAGGAAGG - Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142234473 16:88915275-88915297 GTGGGGAAACTGGTGGGTGGTGG + Intronic
1143779662 17:9222580-9222602 GTGAGGAAAGAGGAGGAGGGAGG + Intronic
1144830643 17:18129262-18129284 GTGGGTAAACACCAGAAGGGTGG - Intronic
1145977471 17:28992719-28992741 GAGGGGACACTGGAGGAGAGAGG - Intronic
1146802117 17:35833283-35833305 GTGGGTATAGAGTAGGAGGGCGG + Intronic
1147339287 17:39744316-39744338 GATGGTAAACTGGAGGTGGCTGG - Intronic
1147999054 17:44377042-44377064 GTGGGGAATCTGGAAGAGGCTGG - Exonic
1148535835 17:48437995-48438017 GTGGGGAAATTGGATGTGGGAGG - Intergenic
1148837637 17:50474268-50474290 GTGTGTAAGGTGGAGGAGGCTGG + Intronic
1149037527 17:52152090-52152112 GGGGGTGAACTGGAGGGGGCTGG - Intronic
1152598372 17:81249247-81249269 GTGGGGGAAGAGGAGGAGGGAGG + Intronic
1152728226 17:81958042-81958064 TTGGGTGGACTGGAGGAAGGCGG + Intronic
1153014509 18:571438-571460 GTGGGCAAACTGGTTGAGGTCGG + Intergenic
1156228832 18:35134573-35134595 GTGGGTACCATGGAGCAGGGAGG + Intronic
1157430522 18:47620630-47620652 CTGGTTATACTGGAGTAGGGTGG - Intergenic
1157983901 18:52415528-52415550 GTTTGTAATCTAGAGGAGGGAGG + Intronic
1158617451 18:59001317-59001339 GTGGGACAACTGGAAGGGGGTGG + Intergenic
1158963954 18:62607639-62607661 GAGGTTATACTGGAGTAGGGTGG - Intergenic
1160017748 18:75157457-75157479 GAGGTCATACTGGAGGAGGGTGG + Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1161170920 19:2812185-2812207 GTGAGGAAACTGGAGGTTGGAGG - Intronic
1161519660 19:4716731-4716753 GTGGGGAAACTGAAGCTGGGAGG + Intronic
1161733959 19:5978838-5978860 ATGGGTAACCTGGAGGCGCGCGG - Intergenic
1162200737 19:9018310-9018332 GGAGGGGAACTGGAGGAGGGTGG - Intergenic
1162548955 19:11347820-11347842 GTGGCTATACTGGAGGGGGAGGG + Intronic
1162565902 19:11445820-11445842 CTGGGTTACCTGGTGGAGGGTGG + Intronic
1162788684 19:13051985-13052007 GTGGGTAATCGGCAGGAGGGAGG - Intronic
1163241447 19:16066454-16066476 GTGGGAAAACTGGAGTACAGGGG + Intergenic
1163587242 19:18170663-18170685 GCAGCTAAACTGGGGGAGGGAGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167299851 19:48672153-48672175 GTGGGTAATGAGGAGGAGAGAGG + Intronic
1167409766 19:49338035-49338057 GGGAGGGAACTGGAGGAGGGGGG - Intronic
1167698388 19:51027891-51027913 GAAGGGAAACTGGAGGAGGGAGG - Intronic
1168350425 19:55672585-55672607 GGTTGTCAACTGGAGGAGGGGGG - Intronic
1168644394 19:58050891-58050913 GTGGGGAGATTGGAGGCGGGAGG - Intronic
925001874 2:409719-409741 GTGTGGACACTGGAGGATGGTGG - Intergenic
926024110 2:9524783-9524805 TTGGGAAAACTGGAGAAGGAAGG + Intronic
926151276 2:10426971-10426993 GTTGGTCAGGTGGAGGAGGGAGG - Exonic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
926276903 2:11410832-11410854 CTGGGATAACTGGAGGTGGGAGG - Intergenic
926336071 2:11863847-11863869 GTGGGGAGACTGGGGGAGGCGGG - Intergenic
927712457 2:25334179-25334201 GAGGGTAAGGTGGAAGAGGGTGG + Intronic
928363248 2:30682260-30682282 GTGGGCTACCTGGAGGAGGTAGG - Intergenic
928630225 2:33183973-33183995 GGGGAGAAAGTGGAGGAGGGAGG - Intronic
929614175 2:43295292-43295314 GTGGGCAAGCTGGAGGGTGGAGG + Intronic
930655653 2:54004698-54004720 ATGGGTAAACTGGCTGAGCGCGG - Intronic
930887782 2:56347703-56347725 CAGAGTGAACTGGAGGAGGGTGG + Intronic
931323248 2:61193332-61193354 GTGGCTAGACTGCAGGAGGGAGG + Intronic
932453969 2:71834467-71834489 GCTGGGAGACTGGAGGAGGGTGG + Intergenic
933041395 2:77471564-77471586 ATGGCTAAAGTGGAGGAGAGAGG - Intronic
933789647 2:85873463-85873485 GTGGGGACAAGGGAGGAGGGAGG + Intronic
934925958 2:98381877-98381899 GTGGGGAAAGAGGAAGAGGGAGG + Intronic
937080461 2:119136514-119136536 ATGGGTAAACAGGGGAAGGGCGG - Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
938690055 2:133779280-133779302 TTTGGTAAAATGGAGGAGAGAGG - Intergenic
938866021 2:135421574-135421596 GTTGGAAATCTGGAAGAGGGAGG - Intronic
940296085 2:152126252-152126274 GTGGGTAATGTGCTGGAGGGTGG + Exonic
941336296 2:164247953-164247975 GTGGTCATACTGGAGTAGGGTGG + Intergenic
943689158 2:190851272-190851294 GTAGGTAAACTGAAGGAGGCTGG - Intergenic
944770484 2:202909724-202909746 GTCAGTAAAATGGAGGCGGGGGG - Intronic
945056466 2:205873596-205873618 GTGGCAAGACTGGAGCAGGGAGG + Intergenic
945250847 2:207765786-207765808 GTGCTTGAACTGGGGGAGGGAGG - Exonic
946109744 2:217404128-217404150 GAGACTCAACTGGAGGAGGGAGG - Intronic
946513983 2:220391775-220391797 GTGGGTGCAGGGGAGGAGGGAGG + Intergenic
947137061 2:226985860-226985882 CTGGATAAACTGGAAGAGGTAGG - Intronic
947636758 2:231684260-231684282 GTGAGTAAACGGGGGGGGGGGGG - Intergenic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
948051531 2:234982704-234982726 GTGGGCAAATGGGAGGAGGTGGG + Intronic
1168791393 20:578951-578973 GTGGGGTAAGGGGAGGAGGGAGG - Intergenic
1168877679 20:1182480-1182502 GGGGGCAAAGTGGAGGATGGGGG + Intronic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1171428124 20:25061245-25061267 GAGGGTACACTGGATCAGGGAGG - Intergenic
1171906731 20:30905458-30905480 GTAGGCCAACCGGAGGAGGGTGG - Intergenic
1172445242 20:34989961-34989983 GTGGGAGACCTGGAGCAGGGCGG - Intronic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1173341257 20:42154843-42154865 GTGGGAGAACTGGAGCTGGGGGG + Intronic
1174360859 20:50028097-50028119 GGGGATAATCTGGGGGAGGGAGG + Intergenic
1174875492 20:54222801-54222823 GTGGGGAAAATGCAGGTGGGAGG + Intronic
1177112136 21:17041431-17041453 CAGGGTAAAGTGTAGGAGGGGGG - Intergenic
1177608036 21:23407767-23407789 GTGGGTGAACGGGTGGAGGAAGG - Intergenic
1178499117 21:33111015-33111037 GTGGGTAAACTGAGGTACGGGGG + Intergenic
1180049692 21:45325495-45325517 GTGGGCAGAGTGGGGGAGGGAGG + Intergenic
1181328074 22:22066567-22066589 GTGGGAAAACCGGAGGAAAGGGG + Intergenic
1181766222 22:25094201-25094223 GTGGTTAAACGGGAGCAGGGAGG + Intronic
1182305142 22:29362771-29362793 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182312452 22:29418925-29418947 GTGAGTTAACTGGAGTAGGTGGG - Intronic
1182687812 22:32134339-32134361 GTGAGTTAACTGGAGTAGGTGGG + Intergenic
1182786919 22:32915677-32915699 GTGGGTAAGGGGCAGGAGGGTGG + Intronic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1184014616 22:41776583-41776605 GTGAGAAATCTGGAGGAGGATGG + Intronic
1184102668 22:42348993-42349015 GTGGGGGAACTGGAGGTGGGAGG + Intergenic
1184141884 22:42582325-42582347 ATGGGTAGACTGCAGGAGAGGGG + Intergenic
1184304173 22:43584195-43584217 GTGGGGAAAGTGGCAGAGGGAGG + Intronic
1184350109 22:43937707-43937729 GTGGGTGGACAGGTGGAGGGAGG - Intronic
1184609754 22:45595156-45595178 GTGGCTAGGCTGGAGGAGTGTGG + Intronic
1184808206 22:46810109-46810131 CTGGGTGTTCTGGAGGAGGGAGG + Intronic
1185108026 22:48885346-48885368 GTGGGAGGACGGGAGGAGGGAGG - Intergenic
1185153701 22:49180605-49180627 GTGGGGAAACAGGAGCAGGGAGG - Intergenic
1185360736 22:50405228-50405250 GTGGTTAGACTGGAGGTGAGAGG + Intronic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949433326 3:4002095-4002117 CTGGGAAAACTGCATGAGGGTGG + Intronic
949947904 3:9204518-9204540 GGAGATAAAATGGAGGAGGGAGG + Intronic
950474495 3:13206987-13207009 GTGGCTAACCAGGAGGCGGGAGG - Intergenic
950704505 3:14771594-14771616 GAGGCCATACTGGAGGAGGGTGG - Intronic
951022864 3:17799565-17799587 GCTGGTAAAATGGTGGAGGGAGG - Intronic
952150631 3:30586249-30586271 GTGGGTAAATAGGAGAAGAGTGG - Intergenic
953228970 3:41046404-41046426 CTGGGGAAACTGGAGGAAGGGGG - Intergenic
954855913 3:53643324-53643346 GTGGGTAAACCACAGGAGGCTGG - Intronic
955441789 3:58963879-58963901 GTGTGTAAACTGCAAAAGGGAGG - Intronic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956748314 3:72327106-72327128 GTGGGTAGATTGGTGGATGGAGG - Intergenic
958497615 3:94864626-94864648 GGGAGTAGACTGGAGAAGGGAGG + Intergenic
958768708 3:98401499-98401521 TTAGGTAAACTGGAGAAGGTGGG + Intergenic
958873272 3:99586731-99586753 GTGGGAAAGCTAGAAGAGGGAGG - Intergenic
959348251 3:105227122-105227144 CTGGGCAATCTGGAAGAGGGAGG - Intergenic
960986546 3:123284739-123284761 GTGGGGGAACAGGAGGAGAGAGG + Intronic
961745231 3:129060323-129060345 TTGAGTATACAGGAGGAGGGAGG + Intergenic
961845233 3:129757313-129757335 GTGGGAAGACTGGAGGTGGCAGG - Intronic
962134942 3:132722742-132722764 GTGGGGCAACTGGAGGGGCGGGG + Intergenic
962491293 3:135896550-135896572 GTGGAGAAACTGGAGGGAGGAGG + Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
962894731 3:139704151-139704173 GTGGGTAAGGTGGGGGAGGAGGG + Intergenic
962956368 3:140270606-140270628 GTGTGTAGACAGGAGGATGGGGG + Intronic
963341972 3:144047137-144047159 TTGAGTAAAAAGGAGGAGGGAGG - Intronic
964569491 3:158095797-158095819 GTGGATAAAATGGAGGGGGCCGG + Intergenic
965412103 3:168344999-168345021 ATGAGTAGAGTGGAGGAGGGTGG - Intergenic
965711482 3:171560086-171560108 GGGGGTAGATTGGAGGAGAGTGG + Intergenic
965847967 3:172986825-172986847 GTGAGAAGACTGGAGGTGGGAGG + Intronic
967033691 3:185631560-185631582 GTGGGGAAAGGGGAGAAGGGGGG - Exonic
967295199 3:187957536-187957558 ATGGTTAAACTGGTGGAGGGAGG + Intergenic
968359534 3:198137619-198137641 TTGGGGAAAGTGGGGGAGGGGGG - Intergenic
968547656 4:1206964-1206986 GTGGGGCAATTGGAGGTGGGTGG + Intronic
968652501 4:1765846-1765868 GTGGGGAGAAGGGAGGAGGGAGG + Intergenic
969060656 4:4431730-4431752 GTGGGTCATCAGGAGGAGGGAGG - Intronic
969094129 4:4719310-4719332 GTGGTCATACTGGAGTAGGGTGG + Intergenic
969548455 4:7848069-7848091 GTGGGTGGACGGAAGGAGGGAGG + Intronic
969704061 4:8782571-8782593 GAGGGGGAACTGGAGTAGGGAGG + Intergenic
971539886 4:27802946-27802968 TTGGAGAAACTGGGGGAGGGGGG - Intergenic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
972774308 4:42227415-42227437 CTGGGCAAGCTGGTGGAGGGAGG - Intergenic
972827321 4:42774732-42774754 GTGGGGAAAGTGTAGGAGGTGGG + Intergenic
973613502 4:52658758-52658780 GGGGATAAGCTGGAGGTGGGGGG - Intronic
974194315 4:58551944-58551966 GTGGCTAAACTAGAGGCTGGAGG - Intergenic
974353190 4:60776043-60776065 GTGGGGTGAGTGGAGGAGGGAGG - Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
974655105 4:64808710-64808732 GTAGGGAGACTGGAGGAGGCAGG - Intergenic
975215318 4:71746909-71746931 GTGGGCAGACTGGAGGTGGGAGG + Intronic
976061350 4:81131281-81131303 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
977086435 4:92604753-92604775 GTGGGTAAGCTGAAGGACAGTGG - Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978902593 4:113970650-113970672 TTGGGTAAATTAGAGGAGAGAGG + Intronic
981600666 4:146485047-146485069 GTGGGTAAAAGGGATGAGGTGGG - Intronic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982277791 4:153654585-153654607 GTGGGTAAGGGGGAGGCGGGGGG - Intergenic
983495423 4:168437594-168437616 GTGTCTAAACTGCAAGAGGGAGG - Intronic
984195137 4:176650102-176650124 GAGGTCACACTGGAGGAGGGTGG - Intergenic
984419823 4:179506899-179506921 GTGGGAGAAGTGGAGGAGGTGGG + Intergenic
985364788 4:189216878-189216900 GTGGGTGAGCAGGAGGAGTGAGG + Intergenic
986288939 5:6383370-6383392 GTGGGTAAAATGAAGGACTGAGG - Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
987525514 5:19044941-19044963 ATGGGTAAACTGGGAGAGGAGGG + Intergenic
988835005 5:35023693-35023715 GTGGGCAGATTGGAGAAGGGAGG + Intronic
989775530 5:45202392-45202414 TTGGGTAAAGTGGGGGAGAGTGG - Intergenic
990214170 5:53512951-53512973 GTGGAGGAACTAGAGGAGGGAGG - Intergenic
990314363 5:54570087-54570109 GAGGGTATACTGGAATAGGGTGG + Intergenic
990517334 5:56542414-56542436 GTGGGGAGACTGGAGGAGACAGG + Intronic
991563375 5:67978901-67978923 CTGGGTAAATTGGAGGAGGAGGG - Intergenic
992542730 5:77780502-77780524 GTGGGACAACTGGAAAAGGGGGG - Intronic
997379127 5:133422624-133422646 GTGGGGAAAATCAAGGAGGGAGG + Intronic
999262158 5:150244931-150244953 GAGGGGGGACTGGAGGAGGGTGG - Intronic
999323238 5:150627311-150627333 GAGGGTCAACTGGGGAAGGGTGG + Intronic
999632297 5:153583586-153583608 GTGGTCATACTGGAGTAGGGTGG - Intronic
999684364 5:154089030-154089052 GGGTGTGAACTGGAGGAAGGGGG + Intronic
1001134370 5:169090226-169090248 GAGGGTGAAGGGGAGGAGGGAGG + Intronic
1001756654 5:174175466-174175488 GAGGTCAAACTGGAGGAGAGTGG - Intronic
1002168186 5:177360951-177360973 GTCTGCAAGCTGGAGGAGGGAGG + Intronic
1002679436 5:180949473-180949495 CTGGGTAAACGGGAGACGGGGGG + Intronic
1002888884 6:1317206-1317228 GGGGGTAGGCTGGAGGGGGGCGG - Intergenic
1003713966 6:8625298-8625320 CTGGGAAAACTGGAGGAGTGGGG - Intergenic
1003885948 6:10521436-10521458 GCTGGGAAACTGGTGGAGGGAGG + Intronic
1004280727 6:14277505-14277527 GGAGGCAAAGTGGAGGAGGGAGG - Intergenic
1004632035 6:17431138-17431160 GTGGGCCAACTGGAGGGTGGAGG + Intronic
1006278104 6:33022221-33022243 GAGGGTGAACTAGAGGAGGTGGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008617071 6:53237007-53237029 TTGGGTTTACTGTAGGAGGGAGG - Intergenic
1008628175 6:53337960-53337982 TTGGGCAAACTGGCGGAGGATGG + Intronic
1009482904 6:64182841-64182863 GAGGGTAGACAGGAGTAGGGTGG - Intronic
1009890382 6:69673556-69673578 GTGGGCAACCTGGGGGAGGAGGG + Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010433896 6:75808853-75808875 GTGGGTAAACTCAAGGCAGGGGG + Intronic
1011625740 6:89282188-89282210 GTGGGTGTGGTGGAGGAGGGGGG - Intronic
1013996021 6:116309209-116309231 GTGTGTATACAGGATGAGGGGGG - Intronic
1016777733 6:147923597-147923619 GTGAGAAAACTGGTTGAGGGAGG + Intergenic
1016826402 6:148392346-148392368 GTAGATAAACAGGAGGTGGGAGG - Intronic
1018310552 6:162503817-162503839 GTGGGTAAACAGGAGGGTGATGG + Intronic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019260463 7:79056-79078 TTGGGGAAAGTGGGGGAGGGGGG + Intergenic
1019268569 7:133272-133294 GTCTGTAGACTGGAGGTGGGTGG + Intergenic
1019437342 7:1028820-1028842 GGGGGTAGACTGGAGGAGATGGG - Intronic
1019813541 7:3182798-3182820 GTGGGGAGAGGGGAGGAGGGGGG - Intergenic
1019943427 7:4308674-4308696 AAGGTTAAAATGGAGGAGGGTGG - Intergenic
1020080058 7:5282312-5282334 ATGGGGAAAGCGGAGGAGGGAGG + Intronic
1020411546 7:7897145-7897167 GAGGGTAACATGGAAGAGGGTGG - Intronic
1020573122 7:9890891-9890913 CTGGGTCACCTGGAGGTGGGTGG - Intergenic
1020825163 7:13017862-13017884 GTGGGTAAGCTGGAACAGGAAGG - Intergenic
1023995530 7:45157281-45157303 GGGGGTAGACTGGAGGAAGGTGG - Intergenic
1024178013 7:46860992-46861014 GAGGGTGAGGTGGAGGAGGGAGG - Intergenic
1024827141 7:53404016-53404038 GTGAGTAAACAGGAAGAAGGTGG + Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1029127285 7:98303370-98303392 GTGGGTGAAGGGGAGGAGGCTGG - Intronic
1029651493 7:101895823-101895845 GGGAGTAAACTGGAAGGGGGCGG + Intronic
1029884668 7:103855851-103855873 GAGGTTATACTGGAGTAGGGTGG - Intronic
1029925553 7:104312653-104312675 GTGGCTCAACTGGAGGCTGGAGG + Intergenic
1032537681 7:132678234-132678256 CTGGGGATACTGGAAGAGGGAGG + Intronic
1033604835 7:142919276-142919298 GTGGATAAAAAGTAGGAGGGAGG - Intronic
1035348668 7:158227103-158227125 GTGGATAAATGGGAGGAGGGAGG + Intronic
1035451251 7:158978347-158978369 GTGGAGAAACTGGAGGATGTGGG - Intergenic
1035596067 8:858946-858968 GTGGGGAAACTGGGGTGGGGAGG + Intergenic
1035959882 8:4125376-4125398 GTGGGACAACTGGAGCAGGGAGG - Intronic
1036574838 8:10017853-10017875 GTGGGCACACAGGAGGTGGGTGG - Intergenic
1037820824 8:22133780-22133802 GGGGGTAACCTGGAGGGGAGGGG - Intergenic
1038416970 8:27404219-27404241 GTGGGTCAACTGGAGGAAGCTGG - Intronic
1039944569 8:42118402-42118424 GTGGGCAAACTGGGAGAGGTAGG - Intergenic
1042244127 8:66693978-66694000 CTGGGCAAAGTGGAAGAGGGAGG - Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1043347647 8:79318453-79318475 GTGAGTAAACTAGAAAAGGGAGG - Intergenic
1044979429 8:97700772-97700794 GTTAGTTAAATGGAGGAGGGTGG + Intronic
1045045337 8:98269839-98269861 CTGGGAACTCTGGAGGAGGGAGG - Intronic
1045064917 8:98436226-98436248 GTGGGAGAAATGGAAGAGGGAGG - Intronic
1047054313 8:121147175-121147197 TTAGGTAAACTGAAGGAGGAAGG - Intergenic
1047485834 8:125330032-125330054 GTGGGTAAGCTACAGGAGGAAGG + Intronic
1048303378 8:133267253-133267275 TTAGGTAACCTTGAGGAGGGCGG - Intronic
1049529870 8:143148909-143148931 GTGGGTGAACTGGAGGGGAGGGG - Intergenic
1049701144 8:144013310-144013332 GTGGGTACGCTGGCTGAGGGTGG - Intronic
1049825002 8:144662532-144662554 GTGGATAATGTGGAGGAAGGAGG - Intergenic
1050477314 9:6053530-6053552 GTGAGATGACTGGAGGAGGGAGG + Intergenic
1051344337 9:16138959-16138981 GAGTGAAAACTGGGGGAGGGCGG - Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051991973 9:23162683-23162705 GTCTGTAAACTTGGGGAGGGGGG + Intergenic
1053113875 9:35485213-35485235 ATGGGCAAAGTGTAGGAGGGAGG - Intergenic
1054712852 9:68528987-68529009 GTGGGTTTTCTGGAGGAGGTGGG - Intronic
1057321182 9:94014444-94014466 GTGAGTTAACAGGGGGAGGGAGG - Intergenic
1057395983 9:94680805-94680827 GAGGTTATACTGGAGGAGGGAGG + Intergenic
1057529844 9:95834814-95834836 TTGGGTTTACTGGAGGAGTGAGG - Intergenic
1058299941 9:103359119-103359141 GGGGGAAAAATGGAAGAGGGAGG + Intergenic
1058748200 9:108012722-108012744 GTGGGTTAAGTGAAGGAGGCAGG - Intergenic
1059232569 9:112735098-112735120 GTCTGTAAAGTGGAGGAGAGAGG + Intergenic
1059392409 9:114007518-114007540 CTGGGTAAGAGGGAGGAGGGAGG - Intronic
1059407149 9:114108359-114108381 CTGGGCTAACTGGAGGAGAGTGG - Intergenic
1059752582 9:117262192-117262214 GTGGGTATACGGGAGAAAGGAGG + Intronic
1060299619 9:122367623-122367645 GTAGGTAAAGAGGAGGAGGAAGG + Intergenic
1060887298 9:127163623-127163645 GTGTGTACCCTGGAGGAGGCAGG + Intronic
1061482851 9:130905680-130905702 GTGGGAAGACTGCAGGAGGCGGG + Intronic
1185512541 X:674206-674228 GAGGTTGTACTGGAGGAGGGTGG - Intergenic
1187046990 X:15656544-15656566 GTGGGCAGACTGAAGGAGTGTGG - Intronic
1190580892 X:51892711-51892733 GTTGCTCAAATGGAGGAGGGAGG + Intronic
1192966632 X:76183566-76183588 GTGGGCAAACTGAAGCAAGGTGG - Intergenic
1197964945 X:132050185-132050207 ATGGGTCAACTTGTGGAGGGGGG - Intergenic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1199381914 X:147181372-147181394 CTGGGTAAGGTGGAAGAGGGAGG + Intergenic
1199493558 X:148427650-148427672 TGGGGTGAACTGGAAGAGGGAGG - Intergenic
1199697746 X:150355139-150355161 GTGGTTATACTGGAGTAGGATGG + Intergenic
1200234965 X:154463781-154463803 CTGGAGAAAGTGGAGGAGGGCGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic