ID: 986807856

View in Genome Browser
Species Human (GRCh38)
Location 5:11325840-11325862
Sequence CTCCTATGTTGAAGGAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986807856_986807865 30 Left 986807856 5:11325840-11325862 CCAGCATTCCTTCAACATAGGAG 0: 1
1: 0
2: 1
3: 18
4: 221
Right 986807865 5:11325893-11325915 CTATGAGGACTGCACCCAAATGG No data
986807856_986807860 -4 Left 986807856 5:11325840-11325862 CCAGCATTCCTTCAACATAGGAG 0: 1
1: 0
2: 1
3: 18
4: 221
Right 986807860 5:11325859-11325881 GGAGACCACTGGCCATGGAGTGG 0: 1
1: 3
2: 9
3: 68
4: 337
986807856_986807859 -9 Left 986807856 5:11325840-11325862 CCAGCATTCCTTCAACATAGGAG 0: 1
1: 0
2: 1
3: 18
4: 221
Right 986807859 5:11325854-11325876 ACATAGGAGACCACTGGCCATGG 0: 1
1: 0
2: 3
3: 24
4: 224
986807856_986807863 15 Left 986807856 5:11325840-11325862 CCAGCATTCCTTCAACATAGGAG 0: 1
1: 0
2: 1
3: 18
4: 221
Right 986807863 5:11325878-11325900 GTGGTTCTCGCCAGTCTATGAGG 0: 1
1: 0
2: 0
3: 11
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986807856 Original CRISPR CTCCTATGTTGAAGGAATGC TGG (reversed) Intronic
900033809 1:390523-390545 CACCTATGTGGAAGGAACACTGG - Intergenic
900054644 1:620413-620435 CACCTATGTGGAAGGAACACTGG - Intergenic
901099222 1:6706523-6706545 CTCCTAGGTTTAAGCAATTCTGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
908469010 1:64423735-64423757 CTCTTATCAGGAAGGAATGCTGG - Intergenic
908889488 1:68827609-68827631 CCCCTTTGTTTAAGAAATGCAGG + Intergenic
909169491 1:72276949-72276971 CTCCTAGGTTGAAGGAATAAAGG + Intronic
909238116 1:73178881-73178903 CTCATCTGCTGAAGGAATGTGGG + Intergenic
909530448 1:76675890-76675912 TTCCTAGGTTCAAGGAAAGCAGG - Intergenic
909858439 1:80572299-80572321 CTCACATGTTGAAAGAATGAGGG + Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
911538109 1:99124829-99124851 CTCCTGGGTTGAAGGAATTCTGG + Intergenic
911696924 1:100899590-100899612 CTCCCAGGTTCAAGGGATGCTGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913115777 1:115695689-115695711 CTCCTATCTTGAAAGAATGTGGG - Exonic
915350165 1:155219522-155219544 TTCCTGTGTTGAAGGCATCCTGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
919564442 1:199166290-199166312 CTCCTAGGTTTAAGCAATTCTGG - Intergenic
922256165 1:223894679-223894701 CACCTATGTGGAAGGAACACTGG - Intergenic
923281862 1:232450849-232450871 CTCATATTTTGAGAGAATGCTGG + Intronic
924337372 1:242997545-242997567 CACCTATGTGGAAGGAACACTGG - Intergenic
1067098881 10:43320467-43320489 ATTCTATGTTGAAGAACTGCAGG - Intergenic
1067711122 10:48651929-48651951 CTCCTATGTCCAAGGACCGCTGG - Intronic
1071896791 10:90076414-90076436 CTCCTCTCTTGAAGGAGTACAGG + Intergenic
1073034249 10:100552235-100552257 ATCCAAGGATGAAGGAATGCGGG + Exonic
1074686694 10:115968438-115968460 CTCCAGTGGTGAAGGAGTGCAGG + Intergenic
1075222456 10:120596939-120596961 CTCCTCTTTTTAAGGAAGGCTGG - Intergenic
1075386344 10:122058034-122058056 CTCTTGTGTGGAAGGAATGCTGG - Intronic
1076389906 10:130091306-130091328 CTCCTTTGCTGCAGGTATGCTGG - Intergenic
1076838797 10:133034494-133034516 CTCCCATGTGGAAGGAATAAAGG + Intergenic
1077131661 11:976026-976048 CTTCTATGTTGAAGGACTGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082705265 11:56487039-56487061 CTCTTATCAAGAAGGAATGCTGG - Intergenic
1084433491 11:69124146-69124168 ATCCTATCTTGTCGGAATGCGGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1088063651 11:105688733-105688755 CAGCTATGTTGAAGGAATGATGG - Intronic
1088381341 11:109196556-109196578 CCTCTATGTTGAAGGAATTTGGG + Intergenic
1089330946 11:117688530-117688552 CTCCTATCTTTAAGGGAGGCAGG + Intronic
1092400917 12:8177813-8177835 CTCATATTTTGAAGAAATACTGG + Exonic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096025236 12:48355059-48355081 CTGCTCTGTTGATGGAATTCTGG + Intergenic
1096688979 12:53307859-53307881 CCCCTTTGTTGAAGGAAGGATGG + Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098259307 12:68651848-68651870 CTGCTTTGTTGAAGTATTGCTGG + Intronic
1099620789 12:85000637-85000659 CTCTTATTAAGAAGGAATGCAGG - Intergenic
1099793605 12:87366993-87367015 CTCTTAGGTTGAAATAATGCTGG + Intergenic
1106872768 13:34039454-34039476 CTCCAATGTTGATGTAATGTAGG - Intergenic
1107019866 13:35740396-35740418 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1112734231 13:102399988-102400010 CTCCTTTGCTGCAGGAATGGTGG + Intronic
1112766572 13:102752075-102752097 CTCTTATCAGGAAGGAATGCTGG - Intronic
1112960048 13:105112833-105112855 CTCTTATCTGGAAGAAATGCTGG - Intergenic
1117257941 14:53999437-53999459 CACCTGCGTTGAATGAATGCAGG - Intergenic
1118825065 14:69372389-69372411 CTGGTCTGTTGCAGGAATGCTGG + Intergenic
1119034482 14:71218108-71218130 CTCCTTTGTTGAATGAATAAGGG - Intergenic
1119831330 14:77705318-77705340 CTCCCAGGTTGAAGCAATTCTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122447316 14:101779574-101779596 CTCCTTTATTTCAGGAATGCTGG - Intronic
1122761054 14:104026861-104026883 CTCTTATGTTGATGGCATCCTGG - Exonic
1123572899 15:21632925-21632947 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1123609519 15:22075512-22075534 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1127134650 15:55907002-55907024 CTCCCAGGTTGAAGCAATTCTGG - Intronic
1131409991 15:92199627-92199649 CTCTTATCAGGAAGGAATGCTGG + Intergenic
1202981761 15_KI270727v1_random:367297-367319 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1133872934 16:9706415-9706437 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1137419251 16:48317212-48317234 CTCCTAAGTTGAATGTATTCAGG - Intronic
1137498156 16:48987034-48987056 CTCCTGTGTTGCAGGAAGTCAGG - Intergenic
1137626427 16:49911537-49911559 CTGCCATGATGAAAGAATGCAGG + Intergenic
1138189979 16:55006896-55006918 CTCCTCAGTTCAAGCAATGCCGG - Intergenic
1140458595 16:75119455-75119477 CTTCCATGTTGATGGAAGGCAGG + Intergenic
1140915917 16:79493271-79493293 CTCCTGGGTTGAAGCAATTCTGG + Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1146674641 17:34764864-34764886 GTCCTATGTTGAACAAATGTGGG - Intergenic
1150393275 17:64802437-64802459 CTCCTACGTTGAGGGACTACGGG - Intergenic
1150920287 17:69475682-69475704 CTCCTAGGAAGAAGGAATGCAGG - Intronic
1152811195 17:82383505-82383527 CTCCCATTTGTAAGGAATGCTGG - Intergenic
1153148526 18:2061243-2061265 CATATATGTAGAAGGAATGCAGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1156547874 18:37983820-37983842 CTCCTCATTTGAAGGGATGCAGG - Intergenic
1157999920 18:52606142-52606164 CTTCTATCTTCAAGGAAGGCTGG + Intronic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1160118411 18:76104536-76104558 CTCCCATCTTGGAGGAAAGCTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1165357475 19:35312735-35312757 CTCCTATGTTGAAAGCTTCCTGG + Intronic
1168701872 19:58445023-58445045 CTCCTAAGTTCAGGGAATGTGGG + Intergenic
929991564 2:46793872-46793894 CTCTTATCAGGAAGGAATGCTGG + Intergenic
931365167 2:61613040-61613062 CTTCTATGTGTAAGGAATTCTGG + Intergenic
931464058 2:62471636-62471658 CACCTATCCTGAAGGAGTGCTGG + Intergenic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
937471981 2:122181925-122181947 CTGCTCTGTTGAAGGATTTCTGG + Intergenic
938695587 2:133832580-133832602 CTCCTACTTTCAAGGAAGGCTGG - Intergenic
939126513 2:138184163-138184185 CTCCTGGGTTCAAGGAATTCTGG + Intergenic
940612276 2:156006714-156006736 CTCCTATCTTGGAGCAATGTGGG - Intergenic
941374155 2:164706799-164706821 CTGCTATGTTGAAGGACTATAGG - Intronic
942593012 2:177566214-177566236 ACCCTATGGTGGAGGAATGCTGG - Intergenic
943050718 2:182910126-182910148 CTACTATCTTGGAGGACTGCAGG + Intronic
943921795 2:193716288-193716310 TTCTTATGTTCAAGGAATACTGG - Intergenic
944141285 2:196459716-196459738 CTCTTATCAAGAAGGAATGCTGG - Intronic
948541540 2:238694626-238694648 CTCCTTTGTTCAGGGAAGGCTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168941949 20:1720295-1720317 TACCTATGTTCAAGGGATGCAGG + Intergenic
1170218668 20:13918139-13918161 CTGCTAAGTTGAAGGTATGGGGG - Intronic
1170466427 20:16626538-16626560 CTCTTTTCTGGAAGGAATGCAGG - Intergenic
1171036062 20:21713899-21713921 CTCCTACGTCGGAGGAATCCAGG + Intronic
1171364578 20:24615276-24615298 CTCCAATGTTGCAGGAAACCGGG + Intronic
1172540523 20:35712000-35712022 CTCCTGGGTTCAAGGAATTCTGG - Intronic
1173236278 20:41248703-41248725 CTCCTCTGTGGAATGAATGTGGG + Intronic
1174159234 20:48538997-48539019 CCCCTGTGTTCATGGAATGCAGG - Intergenic
1174925078 20:54750470-54750492 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1177933049 21:27308932-27308954 CTCCTCTGTTTAAGGAACACTGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1179298185 21:40081809-40081831 CTACTGTGTTTCAGGAATGCTGG + Intronic
1180849216 22:19004773-19004795 CTGGTATTTTGATGGAATGCAGG - Intergenic
1181312086 22:21950442-21950464 CTCCTAAGCTTAACGAATGCAGG + Intronic
1181664508 22:24383268-24383290 CTGGTATTTTGATGGAATGCAGG - Intronic
1183772103 22:39935719-39935741 CTCATTTGTTGTTGGAATGCTGG - Intronic
1184067216 22:42127702-42127724 CTCCTATGTTGGAGGAGGTCAGG + Intronic
951067115 3:18279415-18279437 CTCATATGCTGAAGGGAAGCAGG + Intronic
951074614 3:18374916-18374938 CTTCTATGTTAAAAGAATCCTGG + Intronic
951259502 3:20490185-20490207 CTCCTCTCTTTAAGGAAGGCAGG + Intergenic
951297850 3:20961125-20961147 CTTCTATGATGATGGAAGGCAGG + Intergenic
951307066 3:21077410-21077432 CTAATATTTTGAAAGAATGCAGG + Intergenic
955394315 3:58546580-58546602 TTCCTATCTTAAAGGGATGCTGG + Intergenic
961105579 3:124238185-124238207 CTCCACAGTTGAAGGAATGAGGG + Intronic
961518326 3:127452424-127452446 CTGATATGTGCAAGGAATGCAGG - Intergenic
961791212 3:129378180-129378202 CTCCAATCTTGGAGGAATGTTGG - Intergenic
964030653 3:152135345-152135367 CTCCTAGGTTGTAGGACTTCTGG - Intergenic
964157203 3:153600570-153600592 CCCCTGGGCTGAAGGAATGCTGG - Intergenic
966308371 3:178563751-178563773 CTCCTTTGTTGAAGGACTCTGGG - Intronic
968554380 4:1239783-1239805 TTCCTATCTTGAAGGAAAGTGGG - Intronic
968963050 4:3755074-3755096 CTCCTATCAGGAAGGAACGCTGG - Intergenic
969338472 4:6526002-6526024 CTCTTATCAAGAAGGAATGCTGG - Intronic
972651754 4:41024631-41024653 TCCCTATGTTGAAGGAGGGCTGG - Intronic
973581024 4:52344328-52344350 CTCCTATCAGGAAGGAATGCTGG - Intergenic
973733120 4:53842861-53842883 CTCTTATTAGGAAGGAATGCTGG + Intronic
973925217 4:55730006-55730028 CTCTTATCAGGAAGGAATGCTGG - Intergenic
974492360 4:62583309-62583331 CTACTATGTTCAAGGAAGTCTGG + Intergenic
975655336 4:76635760-76635782 CTCCTATGGTGAAGGAACTACGG - Intronic
976286683 4:83377204-83377226 CTCTTATCATGAAGGAATGCTGG - Intergenic
977042938 4:92037169-92037191 CTTCTGTGATGAAGGAAGGCGGG - Intergenic
977765966 4:100798012-100798034 CTCCTAGGCTGAAGGAAAGATGG + Intronic
977919031 4:102623904-102623926 TTCATTTGTTGAGGGAATGCTGG - Intergenic
979239762 4:118437763-118437785 CACCTATGTGGAAGGAACACTGG + Intergenic
979590992 4:122480175-122480197 CTCTTATCAGGAAGGAATGCTGG + Intergenic
980827665 4:138091806-138091828 CTCTTATCAGGAAGGAATGCTGG + Intergenic
981144121 4:141305061-141305083 TTAGTATGTTGAAGTAATGCAGG + Intergenic
981437447 4:144742171-144742193 CACCCATGTTGAAGGTATCCTGG + Exonic
981438772 4:144758249-144758271 CTAATTTGTTGAAGGGATGCTGG - Intergenic
981821210 4:148889525-148889547 CTGGTAAGTTGGAGGAATGCAGG + Intergenic
984414258 4:179436304-179436326 ATCCTATATTGAAGGATTGAAGG + Intergenic
986385203 5:7226557-7226579 CTACTCAGTTGAAGGAATGTAGG - Intergenic
986807856 5:11325840-11325862 CTCCTATGTTGAAGGAATGCTGG - Intronic
987203382 5:15600228-15600250 CTCTTATCAGGAAGGAATGCTGG + Intronic
991144287 5:63282960-63282982 CTCCTACTAGGAAGGAATGCTGG + Intergenic
991328427 5:65464050-65464072 CTCTTATTTTTAAGGAATGAGGG - Intronic
992468357 5:77029659-77029681 CTCTTATCAGGAAGGAATGCTGG - Intronic
995479815 5:112582733-112582755 CTCGTCTGTTGCAGGTATGCAGG - Intergenic
996933047 5:128914283-128914305 CTCCTTTGTTAAAGGAAAGTTGG + Intronic
998080195 5:139268849-139268871 CTGCTATGTAGAAGGCATGTGGG - Intronic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
999283146 5:150378139-150378161 CTCATGTGTTTGAGGAATGCTGG + Intronic
1002740011 5:181428345-181428367 CACCTATGTGGAAGGAACACTGG + Intergenic
1002949749 6:1798044-1798066 CTCCTTTGTTCAAGAATTGCAGG - Intronic
1003018521 6:2488777-2488799 CTCTCATCTGGAAGGAATGCTGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003471610 6:6440949-6440971 TTTTTATGATGAAGGAATGCTGG - Intergenic
1003798033 6:9628366-9628388 CTCCTATCAAGAAGGAATGCTGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007623042 6:43226393-43226415 CCCCTGTGTTGAGGGAAAGCTGG + Exonic
1011752610 6:90468422-90468444 CTCCTATGAGAAATGAATGCTGG - Intergenic
1012852907 6:104468518-104468540 CACCTAGGTTAAAGGAAAGCAGG + Intergenic
1012971094 6:105731902-105731924 TTCCTCTGTTGAAGGATTCCAGG + Intergenic
1013650598 6:112191090-112191112 CTCCTGGGTTCAAGGGATGCTGG + Intronic
1013766553 6:113580732-113580754 CTCCTATGTTCCAGGTATGGAGG - Intergenic
1013833118 6:114298620-114298642 GTCCTATGTTGCGGGAAGGCAGG + Intronic
1014753518 6:125279071-125279093 CTCCCATGCTGATGGCATGCAGG - Intronic
1017682186 6:156875162-156875184 CTCGTTTAGTGAAGGAATGCGGG - Intronic
1017953737 6:159160786-159160808 CTCCCATGTTGAATCAAGGCTGG + Intergenic
1018593498 6:165453566-165453588 CTCACATTGTGAAGGAATGCAGG - Intronic
1019225792 6:170506936-170506958 CTCTTATCAGGAAGGAATGCCGG + Intergenic
1019245123 6:170703945-170703967 CACCTATGTGGAAGGAACACTGG + Intergenic
1021298323 7:18937815-18937837 TTCCTATGTGGAAGGAAATCAGG + Intronic
1021503203 7:21352420-21352442 TTCCTATTTAGAAGGATTGCAGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1028071960 7:86461309-86461331 CTCTTATTGGGAAGGAATGCTGG - Intergenic
1029206455 7:98871831-98871853 CTGCTATGTTCAGGGAATGGAGG + Intergenic
1029988777 7:104944357-104944379 CTGCTATTTTGCAGGAATGCAGG + Intergenic
1032003352 7:128281144-128281166 CTTCTGTGTTGCAGGAATTCAGG - Intergenic
1032134413 7:129262532-129262554 CTCCTATTAGGAAGGAATGCTGG + Intronic
1032891340 7:136198982-136199004 CTCCTCTGGTCAATGAATGCAGG + Intergenic
1033338728 7:140475250-140475272 CTCCTGGGTTCAAGGAATTCTGG - Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034154839 7:148948287-148948309 CTCCTATGTAGAAGGCATTGAGG - Intergenic
1034542883 7:151770189-151770211 CTCTTATCAGGAAGGAATGCTGG - Intronic
1035503000 8:104257-104279 CACCTATGTGGAAGGAACACTGG - Intergenic
1036514396 8:9430305-9430327 CTCCTATGTTGCGGGAAGTCAGG + Intergenic
1037123576 8:15318398-15318420 CTCTTATCAGGAAGGAATGCTGG + Intergenic
1037373512 8:18205240-18205262 CCCCTATGATGAAGGGAGGCAGG - Intronic
1038795495 8:30705810-30705832 CTCCTGTGCTTAAGGACTGCAGG + Intronic
1039570053 8:38579483-38579505 CTTCTATGTGGTAGGAATGTAGG - Intergenic
1041409902 8:57542072-57542094 CTCTTCTGTGGAAGAAATGCTGG - Intergenic
1041507350 8:58614285-58614307 TCCCTATGTTAAAGGAGTGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044941113 8:97344897-97344919 TTCCTACGTTGAACAAATGCAGG + Intergenic
1047643998 8:126850715-126850737 GTTCTATTTTAAAGGAATGCTGG - Intergenic
1049511611 8:143029812-143029834 CTCCCTTGATCAAGGAATGCTGG + Intergenic
1050030346 9:1379293-1379315 CTCCTAAGTAGTAGGAATACAGG - Intergenic
1050621710 9:7459738-7459760 CTCATATGGTGTAGGAATTCTGG + Intergenic
1053612076 9:39724292-39724314 CTCTTATTGGGAAGGAATGCTGG - Intergenic
1053870110 9:42482284-42482306 CTCTTATTGGGAAGGAATGCTGG - Intergenic
1054086181 9:60746864-60746886 CTCTTATTGGGAAGGAATGCTGG + Intergenic
1054241442 9:62618101-62618123 CTCTTATTGGGAAGGAATGCTGG + Intergenic
1054555570 9:66652624-66652646 CTCTTATTGGGAAGGAATGCTGG + Intergenic
1055170022 9:73245657-73245679 CTTGTGTGTTGAAGGAATGAAGG - Intergenic
1055329697 9:75171085-75171107 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1056705446 9:88948826-88948848 CTCCTATGCTCAAGCAATTCTGG + Intergenic
1057415641 9:94860047-94860069 GTCCTGTGTGGGAGGAATGCAGG + Intronic
1057513823 9:95704135-95704157 CTGATATGTGGAAGGAATGCAGG + Intergenic
1058189156 9:101891864-101891886 CTCTTATGAAGAAGGAATGCCGG - Intergenic
1058243049 9:102590945-102590967 CATATATGTTGAAAGAATGCTGG - Intergenic
1058826073 9:108777077-108777099 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1060099334 9:120824509-120824531 ATCCAATGTTGAAGGAAAACAGG - Exonic
1062251293 9:135596441-135596463 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1203605318 Un_KI270748v1:53153-53175 CACCTATGTGGAAGGAACACTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188019260 X:25138894-25138916 ATCCTATGTTAAAAGAATACAGG + Intergenic
1189150487 X:38701278-38701300 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1189551310 X:42096426-42096448 CTCTTATCAGGAAGGAATGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1195150302 X:102061052-102061074 CTTCCATGTTGATGGAAGGCAGG + Intergenic
1196528744 X:116758806-116758828 CTCATATGTTGAAGGCAAGGTGG + Intergenic
1196534386 X:116824920-116824942 CTCTTATCAGGAAGGAATGCTGG + Intergenic
1199778387 X:151035784-151035806 CTACTATGTAGAAGGCAGGCAGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201362415 Y:13167374-13167396 CTTCTATGATGATGGAAGGCAGG + Intergenic
1202387503 Y:24339593-24339615 CACCTATGTGGAAGGAACACTGG + Intergenic
1202483283 Y:25330535-25330557 CACCTATGTGGAAGGAACACTGG - Intergenic