ID: 986812249

View in Genome Browser
Species Human (GRCh38)
Location 5:11372903-11372925
Sequence AGGAGAGACCACGGCATTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986812249_986812251 -9 Left 986812249 5:11372903-11372925 CCATCAATGCCGTGGTCTCTCCT 0: 1
1: 0
2: 1
3: 13
4: 173
Right 986812251 5:11372917-11372939 GTCTCTCCTGCCTCAGTGCTAGG 0: 1
1: 0
2: 1
3: 44
4: 433
986812249_986812253 -1 Left 986812249 5:11372903-11372925 CCATCAATGCCGTGGTCTCTCCT 0: 1
1: 0
2: 1
3: 13
4: 173
Right 986812253 5:11372925-11372947 TGCCTCAGTGCTAGGATTACAGG 0: 2
1: 10
2: 580
3: 30889
4: 343367

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986812249 Original CRISPR AGGAGAGACCACGGCATTGA TGG (reversed) Intronic
902143786 1:14379500-14379522 AGGAGAGACCACTGTCCTGAAGG + Intergenic
902650344 1:17833168-17833190 AGAAGGGGCCACGGCATTCAGGG + Intergenic
903014922 1:20355530-20355552 AGGAGAGATTAAGGCCTTGAAGG - Intergenic
904490378 1:30855157-30855179 AGGAGACACCTGAGCATTGATGG + Intergenic
908915793 1:69124688-69124710 AGGATAGGCCTGGGCATTGAAGG + Intergenic
915993485 1:160540945-160540967 ACAAGAGACCAAGGGATTGAGGG - Intergenic
916505995 1:165428809-165428831 TGGAGAGCCCAGGGCATTGAGGG + Exonic
917306280 1:173628391-173628413 AGGAGAGCCCACTGCCCTGAAGG + Intronic
917668546 1:177249437-177249459 AGGAGTGGCCACTGCATTCAGGG - Intronic
918300504 1:183199500-183199522 AGGAGAGAGAAAGGAATTGAGGG - Intronic
920983799 1:210864312-210864334 AGGAGAGACTAAGGCATTGCAGG + Intronic
924662820 1:246037589-246037611 AAGAGAGAGAACGGCATTGCCGG - Intronic
1064195461 10:13240598-13240620 AAGAGATACCACAGCACTGAAGG - Intergenic
1064521676 10:16209521-16209543 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
1065797324 10:29319342-29319364 AGGAGAGACAACGGGAGGGACGG + Intergenic
1072040800 10:91604351-91604373 TGGAGAAGCCACGGCATTGTTGG - Intergenic
1073018385 10:100420306-100420328 AGGAGGGACCAGGACATAGAGGG + Intergenic
1074504319 10:114054622-114054644 AGGAGAGAAAACGGCATGAATGG + Intergenic
1075288688 10:121209491-121209513 AGGAGAGACCACAGCGCTGGAGG + Intergenic
1078060434 11:8039527-8039549 AGCTGAGACCAGGGCACTGAAGG + Intronic
1078690908 11:13579627-13579649 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1085983686 11:81757409-81757431 AGGAGAGACAAAGGCAGGGAGGG + Intergenic
1088705972 11:112465043-112465065 GGGAGAGACAAAGGCATTAAGGG - Intergenic
1090515656 11:127423741-127423763 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
1091211416 11:133864438-133864460 AGAAGAGACCTGGGCATGGAGGG - Intergenic
1091397217 12:161449-161471 AGTAGGGAGCATGGCATTGAGGG - Intronic
1092312602 12:7374584-7374606 AGCAGAGACCGTGGCATTGAAGG + Exonic
1093131997 12:15403141-15403163 GGAAGAGACCACGCCATTCAGGG - Intronic
1093903284 12:24660986-24661008 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
1094417870 12:30236356-30236378 AGCAGTAACCACGGCAATGAAGG + Intergenic
1098395331 12:70011082-70011104 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1098868635 12:75790183-75790205 AGGAGAGAGCATGGCACAGAGGG - Intergenic
1099752340 12:86791911-86791933 AGGAGAGACACAGGCATTGTGGG + Intronic
1104157553 12:126148520-126148542 GGGAGAGACAATGGCAGTGATGG + Intergenic
1109310058 13:60683145-60683167 AGGAGAGAGGAAGGCATGGAAGG - Intergenic
1109567091 13:64131732-64131754 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1113355479 13:109576071-109576093 AGGAGGGACCAGGGCAGTGATGG - Intergenic
1114742669 14:25114087-25114109 AGGAGAGACCCAGGTATTCAAGG + Intergenic
1121607543 14:95252321-95252343 ATGAGAGCCCACAGCATTGCAGG + Intronic
1123428018 15:20188534-20188556 AGGATAGACCACATCATTTAAGG - Intergenic
1124558212 15:30747227-30747249 GGGAGAGAAGACGGAATTGAAGG + Intronic
1126950677 15:53877325-53877347 GGGAGGGAACATGGCATTGAAGG - Intergenic
1128364511 15:66988266-66988288 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1129661770 15:77556679-77556701 AGCTGAGTCCACGGGATTGAGGG - Intergenic
1130040150 15:80399720-80399742 AGGAGACATGAAGGCATTGAGGG - Intronic
1130995348 15:88900413-88900435 AGGAGAGGCCACAGCCTGGAGGG + Intronic
1131950145 15:97673131-97673153 AGGGGAGTCCACTGCACTGAAGG - Intergenic
1131950207 15:97673490-97673512 AGGAGAACCCACTGCCTTGAAGG - Intergenic
1133012058 16:2918822-2918844 AGGAAAGACCAGTGGATTGAGGG + Intronic
1134403908 16:13938641-13938663 AGCAGAGACCATGGCCTGGACGG + Intronic
1135126153 16:19810970-19810992 AGAAGAGATCAAGGCATTGAAGG + Intronic
1136288108 16:29255700-29255722 AGGAGAGGGCACGGCAATGGTGG + Intergenic
1136856290 16:33661227-33661249 AGGATAGACCACATCATTTAAGG + Intergenic
1137227115 16:46524088-46524110 AGGGGAGCCCACAGCCTTGAAGG - Intergenic
1139827179 16:69766498-69766520 AGGAGAGATCAGGTCATGGAAGG - Intronic
1140873740 16:79130925-79130947 CGAAGAGACCACTGCATTGTTGG + Intronic
1140970600 16:80008841-80008863 AGGAAAGACCCTGGCCTTGATGG + Intergenic
1141626050 16:85261620-85261642 AGGAGAGGGCTGGGCATTGATGG + Intergenic
1142093777 16:88228467-88228489 AGGAGAGGGCACGGCAATGGTGG + Intergenic
1203117875 16_KI270728v1_random:1509705-1509727 AGGATAGACCACATCATTTAAGG + Intergenic
1146008624 17:29177870-29177892 AGGAGAGACCTCTGGTTTGAAGG + Intronic
1147210261 17:38869273-38869295 AGGAAAAACCAAGCCATTGAGGG + Intergenic
1148200947 17:45749737-45749759 AGGAGAGACATTGTCATTGAAGG + Intergenic
1150484350 17:65533447-65533469 AGGAGAGACCCCCACATTGAAGG - Intronic
1153016668 18:588724-588746 AGGAGAGAGAAAGGCTTTGAAGG - Intergenic
1154355490 18:13620933-13620955 AGGAGACACCACGGCACAGTCGG - Intronic
1155425617 18:25703708-25703730 AGGAAAGATCCCAGCATTGAAGG - Intergenic
1159838530 18:73369924-73369946 GGGAGAGACCACCACATTGAGGG + Intergenic
1160428443 18:78794239-78794261 GGGAGAGAGCATGGCATTGGAGG + Intergenic
1160785909 19:900238-900260 AGGAGAGGCCAAGGCACAGATGG - Intronic
1162439008 19:10681191-10681213 AGGAGAGACCAGGGCATGGCTGG - Intronic
1162692999 19:12449349-12449371 AGGGGAGCCCACTGCACTGAAGG - Intronic
1164742993 19:30590462-30590484 AGGAAAGACAAAGGCTTTGAAGG - Intronic
1166790770 19:45397062-45397084 TGGGGAGGCCAGGGCATTGAGGG + Intronic
1168121275 19:54253855-54253877 AGGAGAGAGGCCTGCATTGATGG - Intronic
1168299876 19:55398263-55398285 AGGAGTTACCCCGGCATGGATGG + Intronic
1168417304 19:56176751-56176773 AGGAGAAACCCCAGCATTGGTGG + Intronic
926236340 2:11047739-11047761 AGCTGAGAGCAGGGCATTGAGGG - Intergenic
928006520 2:27567217-27567239 AGGAGAGACCACGACTTCCAAGG + Intergenic
929269438 2:39957615-39957637 AGGAAAGACCATGGCATGCATGG - Intergenic
930092389 2:47540608-47540630 AAGAGAGACATCGGCAGTGATGG - Intronic
931667276 2:64618335-64618357 AGGAGAGAGCAGGGCCTTGAAGG + Intergenic
934488390 2:94738534-94738556 AGAAGAGACCTGGGCATGGAGGG + Intergenic
934742289 2:96733140-96733162 AGAAGAGAGCACAGCACTGATGG + Intronic
935172083 2:100618034-100618056 AGGAGAGACCAGGCCATTGAAGG + Intergenic
935928220 2:108093506-108093528 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
936940368 2:117878363-117878385 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
938163589 2:129007893-129007915 ATGAGTGGCCAGGGCATTGAGGG + Intergenic
943651400 2:190461623-190461645 ATGAGAGAACACAGCATTCAAGG - Intronic
945513238 2:210728744-210728766 AGCAAAGACCATGACATTGATGG + Intergenic
945803699 2:214465002-214465024 AGGAGAGACCTAGGCCTGGAAGG - Intronic
946175329 2:217918966-217918988 AGGAGGGACCACTGCAAAGAAGG + Intronic
947813862 2:233023042-233023064 AGGAGAGTCCAGGGCAATGCAGG + Intergenic
947893052 2:233643437-233643459 AGGGGAGCCCACTGCCTTGAAGG - Intronic
1171248662 20:23632906-23632928 AGAAGAGTCCACTGCATTGTCGG + Intronic
1172855707 20:38000632-38000654 AGAAGAGACCCTGCCATTGAGGG + Intronic
1175319426 20:58074850-58074872 TGGGGAGACCAAGGCATGGAGGG - Intergenic
1179167745 21:38947820-38947842 AAGAGCGTCCACGGCATTTAGGG + Intergenic
1184599421 22:45533736-45533758 AGGAGAGACCGAGGCAGTGCGGG - Intronic
1185310891 22:50153625-50153647 AGGAGAGAGCCCGGCAGGGAAGG + Intronic
952811859 3:37411401-37411423 AGGGGAGACCACTGCCCTGAAGG - Intronic
955093552 3:55775023-55775045 AGGAGAGACAACAGCCTTGTGGG + Intronic
957810497 3:85215203-85215225 AAGAGAGCCCACTGCCTTGAAGG - Intronic
961050692 3:123743638-123743660 AGGAGAGGCCAAGACACTGACGG + Intronic
963003422 3:140704381-140704403 AGGAGAGACCATTGCAGTGATGG + Intergenic
964053935 3:152428728-152428750 AGGAGTGGCCAGGGCATTCACGG + Intronic
965317366 3:167208922-167208944 AAGAGAGGCCACTGCATTAACGG + Intergenic
965349942 3:167599471-167599493 AGGAGAGCCCACTGCCCTGAAGG - Intronic
967549498 3:190773963-190773985 CGGAGAGGCCAGGGCATTGGAGG + Intergenic
968530237 4:1087315-1087337 GGGAGAGACAATGGCATTGGGGG + Intronic
968833520 4:2946152-2946174 TGGAGAGTGCACGGCAGTGAGGG - Intronic
968833524 4:2946180-2946202 TGGAGAGTGCACGGCAGTGAGGG - Intronic
969572030 4:8014731-8014753 AGGAGAAACCCCAGCATGGAGGG - Intronic
970413392 4:15833112-15833134 AGGGGAGCCCACTGCTTTGAAGG - Intronic
972902347 4:43700462-43700484 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
973015131 4:45128587-45128609 AGGAGAAACAACGGCCTTTAGGG + Intergenic
976041118 4:80885962-80885984 AGGGGAGCCCACTGCCTTGAAGG + Intronic
976982091 4:91244022-91244044 AGGAGAGTCCACTGCCCTGAAGG + Intronic
977325676 4:95572201-95572223 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
978116095 4:105022150-105022172 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
978922412 4:114200591-114200613 AGGAAAGACCACTGCCCTGAAGG - Intergenic
979504436 4:121479742-121479764 AGGAGAGCCCACTGCCCTGAAGG - Intergenic
980442981 4:132871446-132871468 AGGGGAGTCCACTGCCTTGAAGG + Intergenic
983839428 4:172438202-172438224 CTGAGAGACCACTGCATTGAAGG - Intronic
986737189 5:10676447-10676469 AGGTGAGACCACTGCTTGGAGGG - Intergenic
986812249 5:11372903-11372925 AGGAGAGACCACGGCATTGATGG - Intronic
987163994 5:15174452-15174474 AGGAGAGCCCACTGTACTGAAGG + Intergenic
991045550 5:62218852-62218874 AGGATAGACCACATCATTTAAGG - Intergenic
992309593 5:75482189-75482211 AGGAGAGACCCAGGCCTTGCAGG + Intronic
999452237 5:151686993-151687015 AGGAGGGACCACGGGGTGGAGGG - Exonic
999531660 5:152469656-152469678 AGGACAGCTCAGGGCATTGAAGG + Intergenic
1001410614 5:171508971-171508993 AGGGGAAACCAGGGCATTGTTGG + Intergenic
1001523816 5:172414559-172414581 TGGAGAGACAAAGGCATAGATGG + Intronic
1003743183 6:8967154-8967176 AGGAGAGACAAGGGCATGCATGG - Intergenic
1005583772 6:27256788-27256810 AGGAGAGACAAAGACACTGACGG + Intergenic
1005803300 6:29448392-29448414 TGGAGAGACAACAGCATTGGAGG - Intronic
1006301625 6:33196465-33196487 AAGAGTGACCAGGGCGTTGAGGG - Exonic
1006321012 6:33319463-33319485 AGGAGAGACGCCTCCATTGAAGG + Exonic
1006394294 6:33777061-33777083 AGGAGAGAGCACACCATTTAGGG + Intronic
1009955906 6:70453066-70453088 AGGAGAGACACCAGCATTAAAGG + Intronic
1012603838 6:101132490-101132512 AGGAGGGGCCACAGCATTGAAGG - Intergenic
1014234655 6:118940542-118940564 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1014840823 6:126218465-126218487 AAGTGAAACCACTGCATTGAAGG - Intergenic
1016086995 6:139926581-139926603 AGGAGACTCCACTGGATTGATGG - Intergenic
1017630570 6:156392676-156392698 AGGAGACAGCAAGACATTGAGGG + Intergenic
1019108304 6:169688364-169688386 AGGAGAGAAGTGGGCATTGACGG + Intronic
1019310150 7:356598-356620 AGGAGGAACAAAGGCATTGAGGG - Intergenic
1019405431 7:881286-881308 AGAAGATACCACGGCACTGTGGG + Intronic
1019999903 7:4749718-4749740 AGCAGAGCCAAGGGCATTGAGGG + Intronic
1021923070 7:25506283-25506305 TGGGGAGCCCACTGCATTGAAGG + Intergenic
1023554124 7:41402300-41402322 GGGAAAGACAATGGCATTGAGGG - Intergenic
1024578015 7:50780669-50780691 AGGAGAGACCAGGGTTTTTAAGG - Intronic
1027414031 7:77955218-77955240 AGGCAAGTTCACGGCATTGATGG - Exonic
1032180505 7:129672724-129672746 AGGAGCGAGCATGGCAGTGAGGG + Intronic
1033938476 7:146619694-146619716 AGGAGAGATCACATCATTCACGG + Intronic
1036651804 8:10648970-10648992 AGGAGGGGCCAGGGCAGTGAGGG + Intronic
1037276861 8:17189733-17189755 AAGAAAGAACACAGCATTGAAGG + Intronic
1037354122 8:17999036-17999058 AGGAGAGCCCACTGCCCTGAAGG - Intronic
1042351643 8:67783345-67783367 AGGAGAGACCACGGGAGAAAGGG - Intergenic
1043366826 8:79542774-79542796 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1043627011 8:82273942-82273964 AGGGGAGCCCACTGCTTTGAAGG + Intergenic
1047356605 8:124128086-124128108 AGGAGGCACCTCTGCATTGATGG + Intergenic
1047363963 8:124195411-124195433 AGGAGAGGCCAAGGCATTTTTGG - Intergenic
1050332950 9:4563630-4563652 AGAAGAGACCAAGACATTGGAGG - Intronic
1051844463 9:21435673-21435695 AGGAGAGTCCATGGCATTAGAGG - Intronic
1053669400 9:40345831-40345853 AGAAGAGACCTGGGCATGGAGGG - Intergenic
1053919196 9:42972072-42972094 AGAAGAGACCTGGGCATGGAGGG - Intergenic
1054380530 9:64485851-64485873 AGAAGAGACCTGGGCATGGAGGG - Intergenic
1054515216 9:66030460-66030482 AGAAGAGACCTGGGCATGGAGGG + Intergenic
1055048935 9:71960206-71960228 AGGAGGGACCAGGGAATGGAGGG + Intronic
1055723650 9:79203654-79203676 AGGAGAGATCATGCCATTTAGGG - Intergenic
1056572488 9:87828189-87828211 AGGAGAGACCAGGAGACTGAGGG - Intergenic
1186602123 X:11049439-11049461 AGGTGAGCCCACTGCCTTGAAGG - Intergenic
1188070540 X:25713071-25713093 GGGAGAGACCACGGAAAAGAAGG + Intergenic
1189890018 X:45591497-45591519 AGGGGAGCCCACTGCCTTGAAGG - Intergenic
1192400270 X:70827494-70827516 AGGAGAGCCCACTGCCCTGAAGG + Intronic
1192521441 X:71804728-71804750 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1193052377 X:77115157-77115179 AGGAGAGCCCACTGCCTTGAAGG - Intergenic
1193455351 X:81724983-81725005 AGGAGAGCCCACTGCCCTGAAGG + Intergenic
1193463467 X:81817984-81818006 AGGAGAGCCCACTGCCATGAAGG - Intergenic
1194791821 X:98160071-98160093 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1194823433 X:98532367-98532389 AGGGGAGACCACTGCCATGAAGG + Intergenic
1196248455 X:113428875-113428897 AGGAGAACCCACTGCCTTGAAGG + Intergenic
1197099539 X:122636495-122636517 AGGGGAGCCCACTGCCTTGAAGG - Intergenic
1197293540 X:124688697-124688719 AGCAGAGGCCACAGCAGTGAGGG - Intronic
1197429461 X:126342645-126342667 AGGGGAGCCCACTGCCTTGAAGG + Intergenic
1198998287 X:142602283-142602305 ATGAGAAACAATGGCATTGAGGG + Intergenic
1199274655 X:145926740-145926762 AGGAGAGCCCACTGCCCTGAAGG + Intergenic