ID: 986814988

View in Genome Browser
Species Human (GRCh38)
Location 5:11399064-11399086
Sequence CGAAGGTCACATTTTAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986814982_986814988 -10 Left 986814982 5:11399051-11399073 CCCTTTGTCCCTCCGAAGGTCAC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 986814988 5:11399064-11399086 CGAAGGTCACATTTTAATGGTGG 0: 1
1: 0
2: 2
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986814988 Original CRISPR CGAAGGTCACATTTTAATGG TGG Intronic
900978873 1:6035056-6035078 CCAAGGTCACCTTCTCATGGAGG - Intronic
902716840 1:18278855-18278877 CCATGTTCACATTTTAATTGTGG + Intronic
904053527 1:27655599-27655621 CAAAGCTCACAGTTTGATGGGGG - Intergenic
906623422 1:47304940-47304962 CAAAGTGCACATTTTGATGGAGG + Exonic
908771194 1:67597993-67598015 GGAAGGTGACATTTGAATGCAGG + Intergenic
909201278 1:72692972-72692994 TCAAGGTCATATTTTAAGGGAGG - Intergenic
910424948 1:87112314-87112336 TGAAGTTCACATTTCAATCGTGG - Intronic
910864092 1:91771858-91771880 AGAAGCTCACAGTTTGATGGGGG + Intronic
910871960 1:91842179-91842201 CGGAGCTTACATTTTAGTGGGGG + Intronic
911534697 1:99087051-99087073 TGAAGCTCACATTTACATGGGGG + Intergenic
911595257 1:99792548-99792570 TGAAGCTCACATTTAAATAGAGG - Intergenic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913595619 1:120373279-120373301 CGAAGGATAAATTTTAAAGGTGG - Intergenic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914091655 1:144505696-144505718 CGAAGGATAAATTTTAAAGGTGG + Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914306890 1:146428164-146428186 CGAAGGATAAATTTTAAAGGTGG - Intergenic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914595160 1:149144634-149144656 CGAAGGATAAATTTTAAAGGTGG + Intergenic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
916033170 1:160896325-160896347 CAAAAATCACATTCTAATGGGGG - Intergenic
916351610 1:163856124-163856146 GGAAGTTAACATTTTGATGGAGG - Intergenic
916887497 1:169084253-169084275 GGAAGCTCACAGTCTAATGGAGG + Intergenic
919688981 1:200511612-200511634 CTCATGTCACATTTTAATGTGGG - Intergenic
920309003 1:205037359-205037381 AGGAGCTCACAGTTTAATGGTGG - Intergenic
924666535 1:246078928-246078950 AGAATGTCTCATTTTTATGGAGG + Intronic
1063745233 10:8871747-8871769 CGAAAGTGACATTGCAATGGGGG + Intergenic
1064847409 10:19670742-19670764 CGAAGTTTACATTTTATTGAAGG - Intronic
1065742312 10:28808129-28808151 TCAAGTTTACATTTTAATGGAGG - Intergenic
1066394918 10:35010854-35010876 TGGAGTTCACAGTTTAATGGGGG - Intronic
1069198708 10:65586793-65586815 GCAAAGTCACATCTTAATGGCGG - Intergenic
1070280598 10:75045403-75045425 GGAAGGTCAGATACTAATGGGGG + Intronic
1072261281 10:93676849-93676871 AGAACGTAACATTTTAATGAGGG - Intronic
1073665791 10:105532330-105532352 TGAAGCTCACATTTGAATAGGGG - Intergenic
1078866368 11:15301856-15301878 AAGAGGTCACATTCTAATGGTGG + Intergenic
1081523630 11:43907627-43907649 CACAAGTCACATTTTCATGGAGG + Intronic
1082748205 11:56990815-56990837 AGAAGGTAACATTTTATTGAAGG - Intergenic
1085422927 11:76379760-76379782 TGAAGATTACATTCTAATGGGGG - Intronic
1087291544 11:96326100-96326122 TGGAGTTTACATTTTAATGGGGG - Intronic
1091242615 11:134064080-134064102 GGAAGGACACTTTTTAGTGGTGG - Intergenic
1095712613 12:45306746-45306768 TGAAGCTAACATTTTGATGGGGG + Intronic
1098772060 12:74564835-74564857 TGAAGGTCAAACTGTAATGGGGG + Intergenic
1099468932 12:83022467-83022489 TGCAGCTCACATTTTAGTGGTGG - Intronic
1099544626 12:83962963-83962985 CAAAGATCACATTTGAATTGAGG + Intergenic
1100218748 12:92481197-92481219 AGAAGCTCCCAGTTTAATGGTGG - Intergenic
1100922375 12:99502610-99502632 CCAAGGTTACATGTTAATGAGGG - Intronic
1102620459 12:114190610-114190632 AGAAGGTGACATTTAAATAGAGG - Intergenic
1102657910 12:114498666-114498688 CTTAGGTCAAATGTTAATGGGGG + Intergenic
1102773714 12:115500808-115500830 AGAAGCTCACATTCGAATGGTGG + Intergenic
1105996546 13:25677989-25678011 AGAAAGTCAAATTTTAATGATGG + Intronic
1106846320 13:33741517-33741539 ATAAGGTCACATTTTGATGTGGG + Intergenic
1107687185 13:42914245-42914267 AGAAGTTTACATTTTAAGGGAGG - Intronic
1110589231 13:77235689-77235711 AGAAGCTCACATTCTAATGAGGG + Intronic
1111912581 13:94328815-94328837 CGAAGGTCACATAGTGATGCAGG - Intronic
1113321679 13:109238579-109238601 CCCAGGTCACATGTTCATGGTGG + Intergenic
1113357239 13:109592629-109592651 CAAAGGGTACATTTTAATGATGG + Intergenic
1117183244 14:53213984-53214006 CTAGGGTCACATTGTAATGTAGG + Intergenic
1117403473 14:55379092-55379114 TGGAGCTCACATTTTCATGGAGG - Intronic
1117623810 14:57615166-57615188 GGAAAGACACATTTTAAAGGAGG - Intronic
1118184932 14:63528905-63528927 AGAAGATCATATTTTAATGGGGG + Intronic
1118592638 14:67412581-67412603 GGAAGGTCACAGTTTTAAGGCGG + Intergenic
1121157920 14:91704276-91704298 AGAAAGTAACATATTAATGGAGG + Intronic
1121817970 14:96943025-96943047 GGAGGGTCACATTATAATTGGGG - Intergenic
1122643514 14:103176495-103176517 CGAAAGTGAGATTTTAATGACGG - Intergenic
1124516224 15:30369317-30369339 AGAAGTTCCTATTTTAATGGAGG - Intronic
1124726696 15:32161414-32161436 AGAAGTTCCTATTTTAATGGAGG + Intronic
1128632291 15:69279411-69279433 AGAAGGTCACATTCCAGTGGGGG - Intergenic
1132291418 15:100706233-100706255 GGAAGGTCACTTTTGAATGAAGG - Intergenic
1138749247 16:59398833-59398855 TGGAAGTCACATTTTAGTGGTGG - Intergenic
1139098655 16:63736906-63736928 CAAAGTTCATATTTTTATGGAGG + Intergenic
1139169866 16:64616890-64616912 AGAAGGTGACATTTTAATTTGGG + Intergenic
1140672019 16:77288691-77288713 AGGAGCTCATATTTTAATGGAGG - Intronic
1142093646 16:88227889-88227911 CCAAGGTCCCATAATAATGGAGG - Intergenic
1143681336 17:8478079-8478101 CGAAGCACACATTCTAGTGGAGG + Intronic
1150908009 17:69359270-69359292 ACAATGTCACATTTTAATTGAGG - Intergenic
1150915603 17:69433637-69433659 AGAAACTCACATTCTAATGGGGG + Intronic
1152813503 17:82393480-82393502 CAATGGTCACCTCTTAATGGAGG + Intronic
1154008637 18:10556984-10557006 CGTGGAGCACATTTTAATGGGGG - Intergenic
1155092693 18:22526913-22526935 CGAAGGCCACATGTCAATGGGGG - Intergenic
1155205459 18:23554301-23554323 GGAAGCTTACATCTTAATGGAGG - Intronic
1156129122 18:33947871-33947893 AAAAAGTCACATTTTAATTGGGG + Intronic
1159128296 18:64250601-64250623 CGAAGGTCAAATTCTAGTTGGGG - Intergenic
1165656165 19:37534029-37534051 TGAAGAGCACAGTTTAATGGAGG - Intronic
925604310 2:5642634-5642656 CGAAGGATAAATTTTAAAGGTGG - Intergenic
929620534 2:43349719-43349741 CAAAGGTCAGATATAAATGGGGG + Intronic
931254808 2:60561121-60561143 CCAAGGTCACATTTTGGTGGAGG - Intergenic
932074064 2:68646702-68646724 AGAAGGTCATATTTTAGTAGAGG - Intronic
932920841 2:75913653-75913675 TGAAGGTGATTTTTTAATGGTGG + Intergenic
935656940 2:105431294-105431316 TGGAGTTCACATTTTATTGGAGG + Intronic
935897662 2:107755134-107755156 GGAAGGTGAGATTTTAATGAAGG - Intergenic
941964304 2:171285657-171285679 TGAAGCTCACATTTTAATGTGGG - Intergenic
943677773 2:190733083-190733105 CGAAGGTCTCATTGTAAGGACGG + Intergenic
944876924 2:203971908-203971930 AGAAAGTCACATTGAAATGGAGG + Intergenic
945423339 2:209666376-209666398 CAAAAGTCACATTTTAAGAGAGG + Intronic
945903572 2:215566045-215566067 CTAAGGTCACATTCCAAGGGAGG - Intergenic
946131262 2:217608738-217608760 TCAAGGTCACATTTGCATGGTGG + Intronic
947964134 2:234264987-234265009 AGAAAGACACATTTTAATCGTGG + Intergenic
1169233182 20:3906742-3906764 GGAAGGTCCCAATTTAATGAGGG - Intronic
1172002382 20:31789223-31789245 GGGAGCTCACATTCTAATGGAGG - Intronic
1174368718 20:50071970-50071992 TGAAGCTGACATTTTAGTGGGGG + Intergenic
1175530255 20:59670095-59670117 GGAAGGTCCCATTCTAGTGGGGG + Intronic
1177347907 21:19897666-19897688 ATATGGTGACATTTTAATGGAGG + Intergenic
1181018173 22:20083300-20083322 CAGAGCTCACATTTTAGTGGGGG - Intronic
1183896422 22:40973091-40973113 CAAAGGTCACATTTGTATAGCGG - Exonic
949637397 3:5998060-5998082 AGAAGGTTACATGATAATGGAGG + Intergenic
950961107 3:17108957-17108979 TGGAGGTTACATTCTAATGGGGG + Intergenic
953691157 3:45120855-45120877 CAAAGGTCACATTTTCAGAGTGG + Intronic
954778638 3:53043706-53043728 AGAAGGTCACTTTTCAGTGGGGG - Intronic
955712585 3:61795825-61795847 CAAAGGCCACTTTGTAATGGGGG - Intronic
956859380 3:73307425-73307447 TGAAGTTCAGATTCTAATGGGGG - Intergenic
957122783 3:76117732-76117754 CGAAGCTTACATTCTAGTGGGGG + Intronic
959610408 3:108287921-108287943 TGGTGGTCACATTTTAGTGGTGG - Intergenic
960280159 3:115772290-115772312 CGAAGCTTACATTTTCATGGAGG + Intergenic
963949870 3:151187475-151187497 TGAAGGTCAAATTTTAAAGATGG - Intronic
965596484 3:170416234-170416256 CGAATGTCAAATTCTAATGGAGG + Intergenic
966974345 3:185071373-185071395 CAAAGGTCACATGTTACTTGTGG + Intergenic
967597787 3:191348151-191348173 CATAGGTGACATTTGAATGGGGG + Intronic
967736224 3:192955394-192955416 TGAAGGTCATATTCTAATTGAGG - Intergenic
970994491 4:22249793-22249815 CAAAGATCACACTTTAATGATGG - Intergenic
976331300 4:83833759-83833781 ATAAGGTCACATTTTGAGGGAGG + Intergenic
977570758 4:98626854-98626876 TGAAGCTTACATTTTAGTGGAGG - Intronic
978294450 4:107187579-107187601 CAAATGTCACCTTTTCATGGAGG + Intronic
982217547 4:153095271-153095293 GGGAGCTCACATTTTAAAGGTGG + Intergenic
982907665 4:161096627-161096649 CGTAGGTCATATTTTTTTGGAGG + Intergenic
984601206 4:181729060-181729082 GGAAGCTTACATTTTAATAGAGG + Intergenic
984719554 4:182957068-182957090 TGGAGCTTACATTTTAATGGTGG - Intergenic
986814988 5:11399064-11399086 CGAAGGTCACATTTTAATGGTGG + Intronic
987235329 5:15936489-15936511 CAAGGGTGACAGTTTAATGGAGG - Exonic
992632406 5:78694710-78694732 CCAAGGTCACATTTTTCTTGGGG + Intronic
993937367 5:94020699-94020721 AGAAGGTCATATTTAAATAGAGG + Intronic
994728796 5:103467633-103467655 TAAAGGTCACATTTTAATAATGG + Intergenic
996053045 5:118953441-118953463 GGAAGGTCAAATTTTCATGCAGG - Intronic
996411181 5:123161338-123161360 TGGAGCTTACATTTTAATGGGGG + Intronic
996588712 5:125121165-125121187 TGGAGGTCACATTTAGATGGGGG + Intergenic
998806057 5:145918838-145918860 CGAAGGTAGTGTTTTAATGGAGG - Intergenic
999700770 5:154225703-154225725 CAAAGTTCACATTTTAATGGAGG + Intronic
999709840 5:154308349-154308371 CCAAGGCCACATTATTATGGGGG - Intronic
999844795 5:155467570-155467592 CGAAGCTTATATTCTAATGGGGG - Intergenic
1000901583 5:166917848-166917870 CGGAGCTTACATTTTAATAGAGG + Intergenic
1001791790 5:174464035-174464057 GGGTGCTCACATTTTAATGGGGG - Intergenic
1003768773 6:9273288-9273310 CGCAGGTCAGATTTAAATGGTGG - Intergenic
1008266522 6:49434466-49434488 ACAAGGTCACATTTTACTGATGG + Intronic
1009422552 6:63479974-63479996 TGAAGTCCACATTTTAGTGGGGG + Intergenic
1010913417 6:81586753-81586775 GAAAAGTCACATCTTAATGGCGG + Intronic
1011078465 6:83463444-83463466 GGAGGCTCACATTCTAATGGTGG + Intergenic
1011536492 6:88381509-88381531 CCAAGGTCATATTTTCAGGGAGG - Intergenic
1011920009 6:92562296-92562318 CGAAGCTAACATTTTACTGAAGG - Intergenic
1015101273 6:129484030-129484052 CGAAGGTCAAAATTTAATCCTGG - Intronic
1018207470 6:161448933-161448955 CCAAGGTCACATTAAAAAGGTGG + Intronic
1020353965 7:7257046-7257068 CGAGGGGCATATTTTAAGGGTGG - Intergenic
1026152438 7:67799664-67799686 CGGAGGTGAGATTTTAAGGGTGG - Intergenic
1026184220 7:68069431-68069453 CGAAGTCCACAGTTTAATGAGGG - Intergenic
1027866134 7:83649243-83649265 AGAAGTCCACATTTTGATGGGGG + Intergenic
1030505459 7:110416608-110416630 TGAAGCTCGCATTCTAATGGGGG - Intergenic
1030984569 7:116226253-116226275 AGAAGCTCACAATCTAATGGGGG + Intronic
1034621481 7:152460646-152460668 AGCAGCTCACATCTTAATGGTGG + Intergenic
1035014260 7:155750985-155751007 CGAAGGTCCCAGTTTATTTGTGG + Intronic
1035887977 8:3312745-3312767 CTAAGGGCACAGTTTAACGGTGG - Intronic
1036584517 8:10110975-10110997 GGAAAGTCACATTTTTATGTAGG + Intronic
1036848681 8:12186690-12186712 CCAAGGTCACCTGTTAATGAAGG + Exonic
1036870042 8:12428971-12428993 CCAAGGTCACCTGTTAATGAAGG + Exonic
1038719392 8:30020115-30020137 TGAAGGTGATATTTTCATGGTGG + Intergenic
1040880240 8:52197022-52197044 AGAATTTTACATTTTAATGGAGG + Intronic
1042387182 8:68190268-68190290 AGAATGTGACATTTTAATGTCGG - Intronic
1043922173 8:85995921-85995943 CGAAACTTACATTTTAATGGAGG + Intronic
1043993694 8:86787218-86787240 TGAAGGTAACATTTGAATTGGGG + Intergenic
1045684507 8:104698524-104698546 CAAAGGTAATATTTTAATAGGGG + Intronic
1047343657 8:124006555-124006577 CCAAGGTGACATTTTAATGGGGG - Intronic
1047701306 8:127452032-127452054 TGAAGGTCACGTTCTAATAGGGG + Intergenic
1051347124 9:16162315-16162337 GGAAGGTCACATTCTAGTGGGGG + Intergenic
1051843761 9:21428593-21428615 CAAAGGTTACATTGTAATGGGGG - Intronic
1055488203 9:76777634-76777656 TGAAAGTCACATTTCAATGCTGG + Intronic
1055864520 9:80796954-80796976 GGAATCTCACAGTTTAATGGAGG + Intergenic
1056177979 9:84054041-84054063 GGAAGGTCACTTTTTAATCTGGG + Intergenic
1056442034 9:86631215-86631237 CGAAGGTCACATTATCAAGTGGG + Intergenic
1056711140 9:88992463-88992485 AGAAGGTTACTTTTAAATGGAGG + Exonic
1058203674 9:102074698-102074720 AGGAGGTAGCATTTTAATGGTGG - Intergenic
1060889617 9:127179666-127179688 CAAAGCTCACATTTTAGTCGGGG + Intronic
1185935622 X:4254083-4254105 GGAAACACACATTTTAATGGGGG + Intergenic
1186405158 X:9295398-9295420 GGAAGATCATATTTTAATAGAGG - Intergenic
1187704365 X:21994600-21994622 CAAAAATCACATTCTAATGGGGG - Exonic
1188098990 X:26058912-26058934 AGAATTTCATATTTTAATGGAGG + Intergenic
1188212108 X:27439249-27439271 AGGAGGTCAGATTTTAATTGTGG - Intergenic
1188879257 X:35471713-35471735 CAACAGTCCCATTTTAATGGAGG + Intergenic
1197403502 X:126022973-126022995 TGCAGCTTACATTTTAATGGAGG + Intergenic