ID: 986816606

View in Genome Browser
Species Human (GRCh38)
Location 5:11419404-11419426
Sequence GCATCATTTGAGTTTAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986816606_986816609 15 Left 986816606 5:11419404-11419426 CCCAGTTTAAACTCAAATGATGC 0: 1
1: 0
2: 3
3: 16
4: 179
Right 986816609 5:11419442-11419464 TATATAATTACAAATAATAGTGG 0: 1
1: 0
2: 6
3: 58
4: 705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986816606 Original CRISPR GCATCATTTGAGTTTAAACT GGG (reversed) Intronic
902091841 1:13909915-13909937 CCATCATCTGGGTTTAAACGAGG - Intergenic
904064525 1:27738840-27738862 GTAACATTTGAGTGGAAACTAGG + Intronic
909360547 1:74754268-74754290 GCATAATTTGATTTTATAGTTGG - Intronic
909431199 1:75589821-75589843 GCATCAGCTGAGTTTGATCTGGG - Intronic
910154237 1:84195118-84195140 GCAACATTTATGCTTAAACTGGG - Intronic
913445468 1:118945769-118945791 GCATCACTGGAGTTTAAAGATGG + Intronic
918008496 1:180564224-180564246 ACAGCATTTGAGTCTAAAGTCGG + Intergenic
918214079 1:182377827-182377849 AAATCATTTGAGAATAAACTGGG + Intergenic
919677482 1:200397946-200397968 GCATCACTTGATTTTAAATTAGG - Intergenic
921654666 1:217720582-217720604 GGATCATTTGAGTCTTACCTGGG + Intronic
923239665 1:232070754-232070776 GCCTCATTTGATTTTCAACTTGG + Intergenic
1063709832 10:8466589-8466611 CCATGATTTGAGTTCAAAATTGG - Intergenic
1064209982 10:13353438-13353460 TCATCATTTGAGCTTAAAATAGG + Intergenic
1066218835 10:33315775-33315797 GCATCATTTCAGGTAGAACTAGG + Intronic
1068847143 10:61690226-61690248 GCATTATTTGCTTTTAAGCTAGG + Intronic
1070000611 10:72374065-72374087 GCTTCCTTTGAGTTCAACCTTGG + Intronic
1071045346 10:81367485-81367507 GCATAATATGAATTTAAACTAGG + Intergenic
1072462592 10:95633537-95633559 GCATCATTTGTGTTGACAATGGG + Exonic
1074670770 10:115788179-115788201 GCATCCTCTGAGTTGATACTGGG + Intronic
1075058479 10:119237830-119237852 GCATCATTCAAGCTGAAACTTGG - Intronic
1075353036 10:121743277-121743299 GCATAAGTTCAGTTTAAAATGGG + Exonic
1078009253 11:7558958-7558980 GCATCATTTTAGTATCACCTGGG + Intronic
1078367072 11:10715640-10715662 CCATCTTTTGAGTTGGAACTGGG - Intergenic
1078368672 11:10727239-10727261 GCATTTTATGAGTTTTAACTTGG - Intergenic
1083847275 11:65343351-65343373 ACAACATTTTAATTTAAACTAGG + Intronic
1084995431 11:72972837-72972859 GAAGCATTTGAGTTTGTACTAGG - Intronic
1086959263 11:92965922-92965944 TATTCATTTGAGTTTGAACTTGG + Intergenic
1087769525 11:102192788-102192810 GCACCATTTAAGTTTAACTTTGG + Intronic
1088302175 11:108370817-108370839 GGATCAGTTGAGGTTATACTAGG - Intronic
1088660227 11:112038095-112038117 GAATCATGTGAGTTTAAACTAGG + Intronic
1089251846 11:117169189-117169211 CCATCATTTTAGTAAAAACTAGG + Exonic
1091641100 12:2238209-2238231 GCATGATATGTGTATAAACTGGG + Intronic
1092669790 12:10849737-10849759 TCATCATTTGATTTTCAATTGGG + Intronic
1093236688 12:16617537-16617559 CCATCATTTGAGTTGAAAAAAGG + Intergenic
1093911511 12:24752888-24752910 GGGTCATATGAGTTGAAACTGGG - Intergenic
1094030735 12:26009072-26009094 GCATCATATAACTTGAAACTTGG - Intronic
1094584324 12:31763778-31763800 GCATCAATTGATTTTCAACAAGG + Intergenic
1095989296 12:48023266-48023288 GCATCTTTTGAGTTTGCATTTGG - Intronic
1097956207 12:65487881-65487903 GCATCATTTCACTCTAACCTGGG + Intronic
1098827543 12:75316202-75316224 GCAACAGTTGAATTTGAACTCGG - Intronic
1099209804 12:79770381-79770403 GCAAAATTTGAATTTAAATTTGG - Intergenic
1099359311 12:81680158-81680180 ACATCATTTTATTTTTAACTAGG + Intronic
1101009435 12:100434248-100434270 GCATCTTTGGAGTTTTAAATAGG - Intergenic
1101572994 12:105972248-105972270 TCATCAATTGACTTTAAAGTTGG + Intergenic
1102982106 12:117250130-117250152 CCATCATTGGAGTATGAACTTGG + Intronic
1109350504 13:61174433-61174455 GTATTATTTGTGTGTAAACTGGG - Intergenic
1110052646 13:70923849-70923871 GCAGCATGTGCGTTCAAACTTGG - Intergenic
1114464551 14:22912115-22912137 TTATTATTTGAGTTTAAACCAGG - Intronic
1114778318 14:25511869-25511891 GCAGAAGTGGAGTTTAAACTGGG + Intergenic
1115387456 14:32814073-32814095 GCAAAATTTGAGTTGAAATTAGG - Intronic
1116674770 14:47891496-47891518 GCTACATTTCAATTTAAACTGGG + Intergenic
1119975108 14:79016481-79016503 GCACACTTTGAGTATAAACTAGG - Intronic
1120011521 14:79421152-79421174 GAATCATTTGACTTTAAGTTTGG + Intronic
1120397759 14:83989979-83990001 TCCTAATTTGACTTTAAACTTGG - Intergenic
1120886873 14:89458605-89458627 GAATAATTTGAGTTTCAACTTGG + Intronic
1124810128 15:32928399-32928421 AAATCATTTGACTTTAAATTTGG - Intronic
1128026795 15:64444619-64444641 GCTTCACTTGAGTTGAACCTAGG + Intronic
1128209858 15:65889812-65889834 GCAACATTTAAGTCTACACTTGG - Exonic
1132003563 15:98204884-98204906 GCATCATTTGAGGATTAAATAGG + Intergenic
1132022565 15:98375482-98375504 CACTCAGTTGAGTTTAAACTGGG - Intergenic
1146003018 17:29142612-29142634 GCAGCATCTGTGTTTTAACTAGG + Intronic
1152539633 17:80968466-80968488 GGATCAGCTGACTTTAAACTAGG - Intergenic
1153055854 18:945598-945620 GAATCAGTTGACTTTAAACTAGG - Intergenic
1153820179 18:8825646-8825668 GCAGCATGTGCGTTCAAACTTGG - Exonic
1155420658 18:25652158-25652180 GTATCATTTGTGATTAAAATTGG - Intergenic
1157393385 18:47321850-47321872 GCATTATTTGGGCTCAAACTGGG + Intergenic
1157912878 18:51635695-51635717 CCATAATTTGACTTTAAAATGGG + Intergenic
1158794472 18:60826662-60826684 AAATCAGTTGAGTTTAAGCTAGG - Intergenic
1159310467 18:66701234-66701256 ACATCATTTGAGGGTTAACTTGG + Intergenic
1166024329 19:40067012-40067034 GTATCATTTAAGATTAAATTTGG + Intergenic
1166683937 19:44784000-44784022 GCTTCACTGGAGTTTAAACAAGG - Intronic
1166969636 19:46557194-46557216 GGATCATTTGAGTTCAGCCTGGG - Intronic
1167218351 19:48180376-48180398 GGATCATTTGAGTTCAGCCTGGG - Intronic
925248279 2:2404429-2404451 GCATAATTTAAGCTTAAAATAGG - Intergenic
928911060 2:36421472-36421494 TAAGAATTTGAGTTTAAACTGGG - Intronic
929926653 2:46217806-46217828 GCATCATCTGAGTTTGGTCTGGG + Intergenic
930463966 2:51721034-51721056 GCATCATTTTAGTTCAAATTAGG - Intergenic
930924971 2:56806482-56806504 GCATCAATGGTTTTTAAACTTGG - Intergenic
932492506 2:72131262-72131284 GCATTATTTGGGTTTAATCTCGG - Exonic
934578355 2:95417540-95417562 GCCTCATTTGATCTAAAACTAGG + Intergenic
934601081 2:95659163-95659185 GCCTCATTTGATCTAAAACTAGG - Intergenic
935553420 2:104481791-104481813 GTATCATTTGTCTTTAAACCAGG + Intergenic
936534456 2:113301329-113301351 GCCTCATTTGATCTAAAACTAGG - Intergenic
938316957 2:130336510-130336532 GCATCATTGAAGTTTGAAGTTGG + Intergenic
939014203 2:136882865-136882887 GAATAATTTGAGTTGAAATTTGG + Intronic
939223737 2:139338600-139338622 GTATCATGTGAGTTTAAATATGG - Intergenic
939226415 2:139370481-139370503 GCATCAGTTGAGTTTAGATGTGG + Intergenic
939603339 2:144221526-144221548 TGATCATTTGAGGTAAAACTGGG + Intronic
940328388 2:152449603-152449625 GTATCATTTGAGAGGAAACTTGG + Intronic
941075684 2:161003871-161003893 GCACCCTTTGATTTTAATCTTGG - Intergenic
941590287 2:167411406-167411428 AAATAATTTGAGTTTAAAATTGG + Intergenic
942665820 2:178315952-178315974 GCTTTATTTGATTTTCAACTTGG + Intronic
944015829 2:195036401-195036423 GTGTCATATGAGTTTAAACAAGG + Intergenic
944285121 2:197941136-197941158 GCAACATTTGTTTTTAAACAAGG - Intronic
944328194 2:198432338-198432360 GGATCATTTGAGTTAAACCAAGG + Intronic
944667721 2:201971036-201971058 GCATCATTTGATCTTGATCTTGG + Intergenic
944998032 2:205316665-205316687 CCATAATTGGAGTTTAAATTCGG + Intronic
947869099 2:233422706-233422728 ACAATATTTAAGTTTAAACTGGG - Intronic
1169341051 20:4796623-4796645 GCAACCTTTGAGTATAAATTGGG - Intronic
1169406239 20:5323716-5323738 GTATCATTTGAGTTTGAACTGGG + Intergenic
1170087054 20:12545196-12545218 GCATCAGTTGAGTTTATTCTGGG + Intergenic
1170317532 20:15059032-15059054 GCAACATTGGAATTTAAATTTGG - Intronic
1173146186 20:40526509-40526531 GCATCATTTGAGGTTGAAGAGGG - Intergenic
1174522518 20:51142678-51142700 GCATGATGTGAAATTAAACTCGG + Intergenic
1174671704 20:52314033-52314055 GCATCAATTGAGTAAAAACGAGG + Intergenic
1177880415 21:26687835-26687857 GCATTATTTGTGTTTAAAGTAGG + Intergenic
1178258302 21:31075445-31075467 GGATCAGTTGAGTTTGAACTTGG - Intergenic
1182814147 22:33144155-33144177 GTATCACTTGAGTTGAAATTAGG + Intergenic
949837924 3:8289372-8289394 TCATCCTTTGAATTTAGACTTGG + Intergenic
952701528 3:36333579-36333601 GCATTATTTTAGTTAATACTAGG - Intergenic
953828256 3:46272803-46272825 GCATCATTTGAGGTCAAAAAAGG - Intergenic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
956990409 3:74756562-74756584 GTATCATTTGACTTTCAACAGGG + Intergenic
957268431 3:77998125-77998147 GCATCATTAGAGTTTAAGAGAGG - Intergenic
957579720 3:82055362-82055384 GAATCATTTGAGTATAAATAAGG - Intergenic
962093639 3:132271103-132271125 TTGTCATTTGATTTTAAACTAGG + Intronic
966652879 3:182321107-182321129 GCATAATTGGTGTTTACACTTGG - Intergenic
969480478 4:7444418-7444440 AAAACATTTGAGTGTAAACTTGG + Intronic
969874020 4:10122783-10122805 GCATCACTTGCTTTTCAACTCGG - Intergenic
970150598 4:13085563-13085585 TCATCATCTGAGTCTAATCTTGG + Intergenic
970514815 4:16818027-16818049 GCATCATATGGGTTTAAACTAGG + Intronic
971094350 4:23382886-23382908 GCATTTGTTGAGTTTACACTGGG - Intergenic
971216588 4:24667731-24667753 GCAACATATGAGTTGAAACTTGG + Intergenic
971814718 4:31472550-31472572 GCATCATTTTAGTTCAAGCTAGG - Intergenic
973025287 4:45261297-45261319 GCCTCACTTGAGTTTCAGCTTGG - Intergenic
974941726 4:68477562-68477584 GCATCCTATGAGTTTCAACCAGG + Exonic
976629918 4:87225588-87225610 ACAGAATTTGAGTTAAAACTTGG + Intronic
978602907 4:110447524-110447546 GCATCATTGGAATTTATTCTTGG - Intronic
978799009 4:112737033-112737055 GCATGGTTTGAGTTCAAATTTGG + Intergenic
978852949 4:113359615-113359637 GCTTAATTTGAGTCTAAGCTTGG - Intronic
979034015 4:115688793-115688815 GCATCATTTAAGTGCAAAGTGGG - Intergenic
979064197 4:116107136-116107158 GCATTATTTGATTTTATTCTTGG - Intergenic
979354866 4:119691399-119691421 ATATCACCTGAGTTTAAACTGGG + Intergenic
979826332 4:125238030-125238052 GCATCATATATGTTTAAAATGGG - Intergenic
979991134 4:127377050-127377072 GCATCATTGGAGCTGAATCTGGG - Intergenic
980466484 4:133190941-133190963 GCATCATTTTCTTTTAAACAAGG - Exonic
983068934 4:163246345-163246367 GAAGCATTTGAGTTCAAAGTTGG - Intergenic
984540451 4:181031204-181031226 GCCTTATTTGAGTATAATCTGGG + Intergenic
986816606 5:11419404-11419426 GCATCATTTGAGTTTAAACTGGG - Intronic
987311143 5:16682190-16682212 GCATCATTAACCTTTAAACTTGG + Intronic
987956313 5:24746584-24746606 GCCTAATTTTAGTTCAAACTGGG - Intergenic
987961188 5:24811148-24811170 GCAGAATTTGGGTTTGAACTTGG - Intergenic
989206775 5:38816996-38817018 GCATCATGTGATTTGAAAATGGG + Intergenic
992094324 5:73347087-73347109 GAATTCTTTGAGTTTATACTTGG - Intergenic
993274323 5:85836865-85836887 AGATCATTTGAGACTAAACTTGG - Intergenic
996135081 5:119831828-119831850 TCATCATTTGAATTTTATCTAGG - Intergenic
1000172914 5:158721295-158721317 GAATCATATGAAATTAAACTAGG + Intronic
1000766587 5:165299283-165299305 GCATCGTTTGACTTTTGACTTGG + Intergenic
1003757803 6:9141815-9141837 GAATCATTTGAGTGTATAGTAGG + Intergenic
1005373056 6:25154907-25154929 GCATTATTGGAGTTTATACCTGG - Intergenic
1005528090 6:26672129-26672151 GCATCATTTGAGCATAAATCAGG + Intergenic
1005530786 6:26703241-26703263 GCATCATTTGAGCATAAATCAGG + Intergenic
1005540010 6:26798405-26798427 GCATCATTTGAGCATAAATCAGG - Intergenic
1005542705 6:26829510-26829532 GCATCATTTGAGCATAAATCAGG - Intergenic
1005595292 6:27373438-27373460 GCATCATATGGCTTTAAAATAGG + Intergenic
1006481573 6:34299069-34299091 GCAGCATTTGAGAAAAAACTAGG - Intronic
1006535063 6:34692483-34692505 GCATCATTTAATTTCTAACTGGG - Intronic
1007592840 6:43033509-43033531 CCATTATTTGACTTTAAAGTAGG - Intronic
1008929266 6:56920607-56920629 GCATAATTTGCTTTTAAATTTGG - Intronic
1010561249 6:77353378-77353400 GCATCAGCTGAGTTTAGTCTGGG + Intergenic
1012616029 6:101281255-101281277 GAATCATTTGAGTTTAATATAGG - Intergenic
1013922038 6:115417182-115417204 GCATGATTTGAGCTTTGACTTGG + Intergenic
1014166043 6:118226035-118226057 GAATAATTTGATTTTAAAATGGG + Intronic
1014298839 6:119654378-119654400 GCGTCAATTGAATTTAAATTAGG - Intergenic
1014707127 6:124761341-124761363 GCATCATCTGAGTATAAATGGGG - Intronic
1015445822 6:133303760-133303782 GAATCAAGTGAGTTTAAAGTAGG - Intronic
1016097207 6:140052887-140052909 GCAGCATTTGAGTTAAGATTTGG - Intergenic
1018012478 6:159684151-159684173 TGAGCATTTGAGGTTAAACTGGG - Intronic
1019073568 6:169369167-169369189 GCAGCATTTGAGTGGAATCTTGG + Intergenic
1021837189 7:24690102-24690124 GCATCATTTCATTTTATATTAGG - Exonic
1022384268 7:29887178-29887200 GCATCTTTGGATTTGAAACTTGG + Intronic
1030700645 7:112635930-112635952 GCATCATTTCTCTTTGAACTGGG + Intergenic
1030942243 7:115667565-115667587 GAATCATTTGAACTTAAACCTGG + Intergenic
1038261380 8:25998694-25998716 TCATTATCTGAGTTTAAAATAGG - Intronic
1041447577 8:57969668-57969690 GCACCCTCTGAGTTTAAATTGGG + Intergenic
1045061111 8:98411902-98411924 GGAATAATTGAGTTTAAACTAGG - Intronic
1046615062 8:116467535-116467557 GCTTCATTTGAGTTGAAATATGG + Intergenic
1047218588 8:122899927-122899949 ACATAATGTGAGTTTTAACTGGG - Intronic
1048629236 8:136223491-136223513 CCATCATTTCACTTTAATCTTGG - Intergenic
1050448808 9:5757742-5757764 GTATCATTTAAATTAAAACTAGG + Intronic
1050693460 9:8254070-8254092 GCATTACTTGACATTAAACTTGG - Intergenic
1051605453 9:18913816-18913838 CAATAATTTGAGGTTAAACTTGG - Intergenic
1051978782 9:22987706-22987728 GCATCATTTTAGATGTAACTGGG + Intergenic
1055601294 9:77921670-77921692 GCTTCATTTGATTTCAAAATAGG - Intronic
1055987393 9:82065045-82065067 ACATCATTAGAATTTAAACAGGG - Intergenic
1057621820 9:96643203-96643225 GCATCATTTGTGTGCCAACTTGG - Intronic
1057813108 9:98273136-98273158 GCTGCATTTGTGTTTAACCTGGG + Intergenic
1058038297 9:100277035-100277057 GCATCACAAGAGTTTGAACTGGG - Intronic
1059782910 9:117548798-117548820 GCATCATTTAAGCTTAGCCTGGG + Intergenic
1060472507 9:123960193-123960215 ATATGATTTCAGTTTAAACTCGG + Intergenic
1185684008 X:1912144-1912166 GCCACATTGCAGTTTAAACTGGG - Intergenic
1187067760 X:15856673-15856695 GCATAATCAGAGTTTAAACTTGG - Intergenic
1187187970 X:17005608-17005630 GTAACATTTGAGTTCAATCTAGG + Intronic
1188435519 X:30154033-30154055 GCATCATTTGAGCATTTACTTGG - Intergenic
1189216040 X:39324828-39324850 CCATCTTTTGAGTTTTAGCTTGG - Intergenic
1192057230 X:67785312-67785334 GCATCATTAGTGTTTAATCTAGG + Intergenic
1192089073 X:68133465-68133487 GCATCTCTTGAGGTTAAACCTGG - Intronic
1198014886 X:132600240-132600262 GCATCATTCTACTTTTAACTGGG + Intergenic
1201700982 Y:16881854-16881876 CAATCAATTGAATTTAAACTTGG + Intergenic