ID: 986824070

View in Genome Browser
Species Human (GRCh38)
Location 5:11501711-11501733
Sequence CATAAGAAGGGGCAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986824061_986824070 2 Left 986824061 5:11501686-11501708 CCCTAATGAATGAGATTAGTGCC 0: 1
1: 110
2: 817
3: 1563
4: 2133
Right 986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG No data
986824062_986824070 1 Left 986824062 5:11501687-11501709 CCTAATGAATGAGATTAGTGCCC 0: 2
1: 103
2: 703
3: 1578
4: 2210
Right 986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986824070 Original CRISPR CATAAGAAGGGGCAGGAGGC TGG Intronic
No off target data available for this crispr