ID: 986825823

View in Genome Browser
Species Human (GRCh38)
Location 5:11521223-11521245
Sequence GGGGGAGAATGTAGAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986825823_986825828 18 Left 986825823 5:11521223-11521245 CCTTCAATTCTACATTCTCCCCC 0: 1
1: 0
2: 0
3: 11
4: 263
Right 986825828 5:11521264-11521286 AACATCCTATTGTAACATCAAGG 0: 1
1: 0
2: 1
3: 15
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986825823 Original CRISPR GGGGGAGAATGTAGAATTGA AGG (reversed) Intronic
901174540 1:7289321-7289343 GGGTGAGAATGAAAAATAGAGGG + Intronic
901733869 1:11299731-11299753 GGGGGAAGAGGTAGGATTGAGGG + Intergenic
901784725 1:11617094-11617116 GGGGGAGAAGGCAGCTTTGATGG - Intergenic
902605218 1:17565352-17565374 AGGGAAGAAGGTAGAAATGAGGG - Intronic
902985756 1:20153134-20153156 GGGAGAGGATGTAGAAAGGAAGG + Intergenic
904618788 1:31763598-31763620 GGGGGAGACTTTAGCATAGATGG + Intronic
904962583 1:34346288-34346310 GGGGGAGAATGGCCAAGTGAAGG + Intergenic
905610121 1:39343279-39343301 GAGGGAGAAGATAGAATAGAAGG - Intronic
910881223 1:91923862-91923884 GGGGAAGAATGCAGAGTGGAAGG - Intergenic
912261915 1:108119359-108119381 AGGGGAGAATGCTGGATTGAGGG - Intergenic
912976256 1:114333390-114333412 GAGGGAGAATGTAGAAAAGTGGG - Intergenic
914729836 1:150360594-150360616 TGGTGAGGATGTAGAACTGATGG + Intergenic
915289838 1:154876080-154876102 GGGAGATAATGTCAAATTGAGGG - Intergenic
916550175 1:165842520-165842542 GTGGGAGAATGTGGAAGTGCAGG - Intronic
917635132 1:176928591-176928613 GGAGGAGATGGTAGAATGGAGGG + Intronic
919010440 1:191954460-191954482 GGTGGAGAAGGTAGAATGGGAGG - Intergenic
919927000 1:202196794-202196816 GTGGGTGAGTGTAGAATTCAAGG + Intronic
920519317 1:206611997-206612019 TGTGGAGAATGCAGAAGTGAAGG - Intronic
922502527 1:226107975-226107997 TGGGGAGATTGTAGAAGTAAGGG - Intergenic
922647023 1:227297784-227297806 AGGAGAGAATGTAGAGTTGTTGG + Intronic
923863701 1:237917468-237917490 GGGGTAGAATTTTGAATAGAAGG - Intergenic
1064526302 10:16260358-16260380 GAGGGAGAAGGTAGAAGGGAAGG + Intergenic
1066130541 10:32389119-32389141 GGGGGTGAATATTGAATTGGGGG + Intergenic
1066350326 10:34631245-34631267 AGGGGAAAATGTTGGATTGATGG - Intronic
1068305446 10:55201522-55201544 GGATGAGAATGTAGAATTTAAGG + Intronic
1070607104 10:77906531-77906553 GTGGGAGAAGGTGGGATTGATGG - Intronic
1071487202 10:86110272-86110294 GGGGGTGAATAAAGAATGGAAGG - Intronic
1072475776 10:95758492-95758514 GGGGGCTAATCTAGACTTGAAGG - Intronic
1073375543 10:103031022-103031044 GGTGGAGTATGTAGATTTTAGGG + Intronic
1073469263 10:103712692-103712714 GGGGCTGAAGGTAGAGTTGAAGG - Intronic
1074695441 10:116046262-116046284 GGGGCAGAAGGTAGAAGTGCAGG - Intergenic
1075261906 10:120970418-120970440 GGGGAAGAATGGGGAATGGAAGG - Intergenic
1075353624 10:121749733-121749755 GGAGGAAACTGTAGAAGTGAGGG - Intronic
1075771072 10:124936383-124936405 TGGGGAGAAGGCAGAATTTAAGG + Intergenic
1077730144 11:4721821-4721843 GAAGGAGAATGTAGAGTTGGAGG + Intronic
1078499359 11:11854553-11854575 GGGGGAGGATATAGAAATGAAGG - Intronic
1078573397 11:12478442-12478464 GGGAGAGAAAGGAGAATTCAGGG + Intronic
1079103540 11:17556554-17556576 GGGGCTGAGTGTAAAATTGATGG + Intronic
1080018521 11:27533515-27533537 GGGAAAGAATGTACAATTTATGG - Intergenic
1083706833 11:64522536-64522558 GGGGGAGAATTTACCAATGAAGG - Intergenic
1086007871 11:82061460-82061482 GGGTGAGAGTGGAGAAATGAGGG - Intergenic
1088102386 11:106169552-106169574 GGAGGATAATGTAGAATGGATGG - Intergenic
1091559250 12:1598542-1598564 GGGTGAGAATGTAAAGTTGTGGG + Intronic
1096013173 12:48240688-48240710 AGGGCAAAATCTAGAATTGATGG - Intergenic
1096068446 12:48759761-48759783 GAGGGAGAAAGTAGACTTGGTGG + Intergenic
1096748271 12:53742793-53742815 GCGGGAGAATGGGGAGTTGAAGG - Intergenic
1098512391 12:71332028-71332050 AGGGGGGAATGGAGAATTGTTGG + Intronic
1099396005 12:82139897-82139919 GGGGGAGATTGTAGAAGTATGGG + Intergenic
1100602623 12:96124959-96124981 AGGGGAGAAGGAAGAAGTGAGGG + Intergenic
1101153921 12:101909506-101909528 GGGGGAGAGTTTAGCCTTGAGGG - Intronic
1102212984 12:111140311-111140333 GGGGGACAATTGACAATTGAAGG + Intronic
1102333917 12:112060607-112060629 GGGAGAGAAGGAAGATTTGAAGG + Intronic
1105962906 13:25358273-25358295 GGGGGAAAATGCAGAATCGAGGG + Intergenic
1107667675 13:42708809-42708831 GGTGGAGAATAAAGAATTGGAGG + Intergenic
1107905738 13:45059478-45059500 AGGGGAAAATGAAGAATTGTAGG - Intergenic
1109320731 13:60806625-60806647 GGAAGAGAATGAAGAAGTGAAGG + Intergenic
1109483064 13:62982070-62982092 GAAGCAGAATGTAGATTTGAAGG + Intergenic
1110868098 13:80420262-80420284 GGGGGAGAAAGGAGAAGAGAAGG - Intergenic
1110868103 13:80420283-80420305 GGGGGAGAAGGGAGAAGAGAAGG - Intergenic
1110868110 13:80420305-80420327 GGGGGAGAAGGGAGAAGAGAAGG - Intergenic
1110868116 13:80420326-80420348 GGGGGAGAAGGGAGAAGAGAAGG - Intergenic
1110868122 13:80420347-80420369 GGGGGAGAAGGGAGAAGAGAAGG - Intergenic
1110868128 13:80420368-80420390 GGGGGAGAAGGGAGAAGAGAAGG - Intergenic
1110868147 13:80420434-80420456 GGGGGAGAAGGGAGAAGAGAAGG - Intergenic
1110868154 13:80420456-80420478 GGGGGAGAAGGGAGAAGAGAAGG - Intergenic
1110937033 13:81304421-81304443 GGGGGAGAATATATAAGTGGAGG + Intergenic
1111562411 13:89968107-89968129 AGGGGACAATGTAAAATGGAAGG - Intergenic
1111651758 13:91099805-91099827 GGGGAAGAAAGTAGAATGGCTGG - Intergenic
1111744496 13:92249686-92249708 GTGGCAGAATGTAGACATGAGGG + Intronic
1112639441 13:101256295-101256317 GGAGGAGAATGGAGGAGTGAAGG - Intronic
1113001054 13:105637760-105637782 GGGGGATAATGTCAAATTGGTGG + Intergenic
1115890412 14:38020606-38020628 GAGGGAGAATGAAGAAAGGAGGG + Intronic
1116756189 14:48951076-48951098 GGGGGAAAATGGAGAATTAATGG + Intergenic
1117634161 14:57724635-57724657 GGGGGAGAATGCAGGATGGCAGG - Intronic
1119140374 14:72262152-72262174 GGTGGAGAATACAGGATTGAAGG + Intronic
1119412406 14:74441375-74441397 GGGTGAGTATATAGAATTCAGGG + Intergenic
1119509881 14:75202716-75202738 TGGGGAGTTTATAGAATTGAAGG + Intergenic
1120526713 14:85584937-85584959 CGGGGGGAAGGTAGAAATGATGG + Intronic
1120952118 14:90051105-90051127 GAGGGAGAAGGTAGAGGTGAGGG + Intergenic
1121406924 14:93724856-93724878 GGTGGATAATGAAGAAATGAAGG + Intronic
1122196845 14:100094336-100094358 GGGGGGGAAATGAGAATTGAGGG - Intronic
1123393722 15:19904171-19904193 GGAGAAGGATGTAGAATTGTTGG - Intergenic
1123763789 15:23454518-23454540 GTGGCAGAATGTAGACATGAGGG + Intergenic
1124134181 15:27019608-27019630 GGGAGAGAAGGCAGAACTGAAGG + Intronic
1127680992 15:61298277-61298299 TGTAGAGAATGCAGAATTGAGGG - Intergenic
1128898881 15:71401022-71401044 GTGGGAGAATGTGCAATTGTGGG + Intronic
1129829185 15:78656859-78656881 GGGAGAGAATGTAGAATAAGAGG - Intronic
1129898611 15:79128255-79128277 GGGGAAAAATGTAGCATAGATGG + Intergenic
1130366328 15:83242922-83242944 AGGGGAAAATGGAGAAATGATGG + Intergenic
1130735651 15:86545772-86545794 AGAGGAGAATGTAGACTTTAAGG - Intronic
1131197531 15:90367496-90367518 GTAGGAGAATGGGGAATTGAAGG - Intronic
1132150651 15:99455829-99455851 GGGGGAGAAAGTAAAAGGGAGGG - Intergenic
1133342473 16:5045552-5045574 GAGGGAGAATGCAGATTTCAAGG + Intronic
1134777158 16:16863279-16863301 GGAGGGGAATGTAGAATTCCTGG + Intergenic
1136856578 16:33664213-33664235 GGGGGAGAATGTGGAAAGGCTGG + Intergenic
1136902618 16:34055610-34055632 GGAGAAGGATGTAGAATTGTTGG - Intergenic
1138217167 16:55214524-55214546 GAGGGAGAAGGTAGAAGAGAAGG + Intergenic
1141438578 16:84014856-84014878 GGGGGCGATGGAAGAATTGAGGG - Intronic
1143874926 17:9984414-9984436 GGGAGAGAAAACAGAATTGAGGG + Intronic
1146508712 17:33427549-33427571 GGGGGAGGATGGAGAGTTGGAGG - Intronic
1146554554 17:33812574-33812596 GGAGTAGAATGTAGGAATGATGG + Intronic
1148289759 17:46434573-46434595 TGCGGAGATTGCAGAATTGACGG - Intergenic
1148311927 17:46652145-46652167 TGCGGAGATTGCAGAATTGACGG - Intronic
1150947742 17:69765759-69765781 AGGGGAGAAGGTAGAAGGGAGGG - Intergenic
1152029987 17:77836264-77836286 GGAGGAGAATGTAGGGTCGAGGG - Intergenic
1153006884 18:504914-504936 TGGTGAGGATGTAGAGTTGAGGG - Intergenic
1153366613 18:4264506-4264528 GAGGTAGAGTGTAGAGTTGAAGG - Intronic
1154517840 18:15192870-15192892 GGAGAAGGATGTAGAATTGTTGG + Intergenic
1155081172 18:22411350-22411372 GGGGGAAAATCTAGAATGGTAGG - Intergenic
1155536245 18:26821185-26821207 GCGGGAGAGTGTAAAATTGTAGG - Intergenic
1156493080 18:37507919-37507941 GGGGAGGAATGTAGAACTGCTGG - Intronic
1157542548 18:48521946-48521968 GGGAGAGAATGGAGAGGTGAGGG + Intergenic
1157703503 18:49780754-49780776 GAGGGAGAGGGTAGAACTGAGGG + Intergenic
1158247606 18:55449769-55449791 GGGGGAGACAGAAAAATTGAAGG - Intronic
1158851749 18:61501776-61501798 GGGGGAGAATGAAGAGAGGAAGG + Intronic
1159372639 18:67548056-67548078 GGGCAAGAATGAAGAAATGATGG + Intergenic
1161284000 19:3459585-3459607 GTGGGAGGATGTGGAGTTGAGGG + Intronic
1162705005 19:12549137-12549159 GAGGCAGAAAGTAGATTTGAGGG - Intronic
1162953377 19:14085112-14085134 GAGGAAGACTGTAGAATTGCGGG - Intronic
1166279798 19:41784264-41784286 GTGTGAGAATTGAGAATTGAAGG - Intergenic
1167167712 19:47810639-47810661 AGAGGAGATTGAAGAATTGATGG - Intronic
1202644314 1_KI270706v1_random:126387-126409 GGATGAGAATGTAGACTTCAGGG + Intergenic
924972390 2:140714-140736 AAGGGAGAATGTCTAATTGATGG + Intergenic
925659185 2:6184306-6184328 GGGAGAGAAAGAAGAATGGAGGG + Intergenic
925976629 2:9146482-9146504 GGGGGAGAAGGTGGGTTTGAGGG - Intergenic
926656853 2:15416848-15416870 GGGGGAAAATGTGGAAGGGAAGG + Intronic
926966493 2:18419533-18419555 GGGGTGGAATATAGAATGGATGG + Intergenic
931099151 2:58975938-58975960 GGGGAAAAATACAGAATTGATGG - Intergenic
932743780 2:74314237-74314259 AGAGGAGAATGTAGACTTGGGGG - Intronic
937628777 2:124074688-124074710 AGTGGAGAATGTGGAATGGAGGG + Intronic
940249341 2:151657258-151657280 GGGAGAGAAAGTAAAACTGATGG + Intronic
941014669 2:160341537-160341559 AGGGGAGAATTCAGAATTCAGGG + Intronic
942421269 2:175810501-175810523 GGGTGAGAATGATGAATAGATGG - Intergenic
942978758 2:182052570-182052592 AGAGGAGAATGTAGGATTGTGGG - Intronic
943493122 2:188581383-188581405 TGGGGAAAATGGAGCATTGATGG + Intronic
944068266 2:195642385-195642407 GAGGGAGAAAGCAGAAGTGAGGG - Intronic
944465282 2:199994373-199994395 GGGAGAGGATGTTGAAATGATGG - Intronic
944506966 2:200422553-200422575 GGGGGAGGAAGAAGAAATGATGG + Intronic
945187611 2:207155637-207155659 GGAGGAGAATGTACAAATTAGGG + Intronic
945421511 2:209642792-209642814 GAGGGAGAATATAGAGTTGCAGG + Intronic
947757482 2:232577936-232577958 AAGGGAGAATGTAGAAAGGAAGG - Intronic
948518800 2:238522840-238522862 GGGAGAGAATGAAGAATAAAAGG + Intergenic
948690420 2:239699036-239699058 GAGGGAGAAAGTAGAATGGTGGG - Intergenic
1170212039 20:13855413-13855435 GGGGGAGAGGGTAGGATAGAGGG + Intronic
1170516346 20:17134250-17134272 TGGGGAGAATGCAGAAATAAAGG - Intergenic
1172001311 20:31779836-31779858 GGGGGAGTTTGTAGATTTGGTGG + Intronic
1176907118 21:14514939-14514961 AGGGGAGAATGTAGATTCAATGG + Intronic
1177386014 21:20410453-20410475 GTAGGACAAAGTAGAATTGATGG - Intergenic
1177433395 21:21019926-21019948 GAGTCAGAATGTGGAATTGAGGG + Intronic
1178061512 21:28858321-28858343 GGAGGAGAAAGGAGAAGTGAAGG - Intergenic
1178193352 21:30313113-30313135 TGGGGAGAATGCAGAATAAAAGG - Intergenic
1178199237 21:30384809-30384831 GATGGAGAATGAAGGATTGAAGG + Intronic
1178557771 21:33608518-33608540 TGGGGAGAATGGAGTGTTGATGG - Intronic
1181536902 22:23551045-23551067 ATGGGAGAATGAAGAATGGATGG - Intergenic
1182960595 22:34470902-34470924 GAGGGAGAAAATAGAATGGAAGG - Intergenic
1184388559 22:44190003-44190025 GGGGGGATATGGAGAATTGAAGG - Intronic
1185031096 22:48443488-48443510 GGGAGAGAAAGTAAAATAGAAGG + Intergenic
1185098473 22:48824885-48824907 GGGAGAGAATGCAGATTTCACGG + Intronic
949626247 3:5869820-5869842 GTGGCAGAATGTAGAATTCCAGG + Intergenic
950157363 3:10732309-10732331 GAGGGAGAATTAAGAATTCATGG + Intergenic
951173396 3:19569824-19569846 AGGGGGGCATGTAGAATTAATGG - Intergenic
951221485 3:20073226-20073248 GGGGGAGACTGTATAACTGAAGG - Intronic
954868018 3:53746170-53746192 GGTGGAGAATCTATAAATGATGG + Intronic
955836887 3:63065612-63065634 TGGGGAAAGTGTAGAGTTGAAGG + Intergenic
955974025 3:64463708-64463730 GAGGGAGAAGGCAAAATTGAAGG - Intergenic
955978682 3:64502523-64502545 GGGGGAGAGTGTCCATTTGAGGG + Intergenic
956036811 3:65102284-65102306 GGTGGAGAATGAAGAATATAGGG + Intergenic
956324564 3:68037089-68037111 AGGGAAGAATGTAGAAATAATGG + Intronic
957214766 3:77305371-77305393 GGGTGAGACTGTAAAACTGAAGG + Intronic
958810296 3:98853155-98853177 GGAGGCGAAGTTAGAATTGATGG + Intronic
960834567 3:121892396-121892418 GTGGGAGACAGTAGAAATGAGGG + Intergenic
964330826 3:155600560-155600582 AAAGGAGAATGTAGAATTAAAGG - Intronic
966072931 3:175901487-175901509 AGGGGAGAAAGTACAACTGAAGG - Intergenic
966898066 3:184460551-184460573 GTGGGAGAATGTACCAGTGAAGG + Intronic
969926978 4:10594258-10594280 GGGGGAGATTGGAGAAATGGTGG - Intronic
971035915 4:22692782-22692804 GGGGAAGAAAGTATAAATGATGG + Intergenic
974375370 4:61069809-61069831 AGGGGAGAATGTAGATCTTAGGG - Intergenic
974563503 4:63553306-63553328 GGAGGAAAATGCAGACTTGAGGG - Intergenic
976204607 4:82612944-82612966 GATGGAGAATGGAGAATGGATGG - Intergenic
977639106 4:99335039-99335061 AGGGGAGAAGGTAGAGTTGAGGG - Intergenic
978844249 4:113253114-113253136 GGGAGAGAATGTAGACTACATGG - Intronic
980782523 4:137510089-137510111 TGGTGAGAATGTAGCAGTGAGGG + Intergenic
980864607 4:138540483-138540505 GGGGGAGAAAGTACTAATGAAGG - Intergenic
981417681 4:144512274-144512296 GCAGGAGAATGAAGTATTGAAGG - Intergenic
982047605 4:151464418-151464440 GGTGGAGAGTGGAGAAATGATGG - Intronic
983264856 4:165497550-165497572 AGAGGAGAAGGAAGAATTGATGG + Exonic
984715980 4:182925566-182925588 GGGAGAGGATTTAGAATTAAAGG + Intergenic
985102353 4:186470961-186470983 GGAGATGAATGCAGAATTGACGG - Intronic
985251376 4:188027733-188027755 GGGGGAGATAGTAGAGTAGATGG + Intergenic
986181373 5:5395889-5395911 GGAGGAGGATGTAGACTTCAGGG + Intergenic
986514587 5:8547869-8547891 GGGGGAGGCTCTAGAATTGGAGG - Intergenic
986825823 5:11521223-11521245 GGGGGAGAATGTAGAATTGAAGG - Intronic
990013301 5:51026491-51026513 GGGGGAGAACGAGGAATTAAGGG + Intergenic
991519031 5:67474562-67474584 GGGAGATAAAGTAGAATTTAAGG - Intergenic
992317272 5:75569435-75569457 GAGGGACAATCCAGAATTGAAGG + Exonic
992548268 5:77836772-77836794 GGGGGAGAATGAATTATAGAGGG - Intronic
994170284 5:96652342-96652364 AGGGAAAAATGTAGAATTGATGG + Intronic
995791740 5:115895859-115895881 TTGGAAGAAGGTAGAATTGATGG + Intronic
996084499 5:119290746-119290768 GAGGCAGAATGTAAAATTGATGG + Intronic
998312616 5:141150779-141150801 GGGTGAGAACGTGGAAGTGAGGG - Exonic
999770734 5:154773768-154773790 GGGGTAGGCTGTAGACTTGAGGG - Intronic
1000108439 5:158083392-158083414 GGGTGAGGATGTACAACTGAGGG - Intergenic
1002844932 6:937597-937619 GGGGGAGAAGGTACAAGAGAAGG - Intergenic
1003162310 6:3646639-3646661 GGGGGAGAGTCTAGAATTTGGGG + Intergenic
1003868910 6:10386170-10386192 GAGGGGGAATGTAAAATTGTAGG + Intergenic
1004716492 6:18221072-18221094 GGGGGAGAAAGTGGCAGTGAGGG - Intronic
1005147622 6:22709538-22709560 GGATGAGACTGTAGAAGTGAAGG - Intergenic
1010649861 6:78440952-78440974 CAGGGAGAGTGGAGAATTGAAGG + Intergenic
1012258642 6:97062306-97062328 GGAGGAGAATGGGGAATAGATGG - Intronic
1014823260 6:126017479-126017501 TGGGGAGAGTGTAGACTAGAAGG - Intronic
1015370031 6:132440111-132440133 GATGGAGAGTGTAGAAGTGAAGG - Intergenic
1016040234 6:139425266-139425288 GGGGGAGAATGTAGAAGGGGGGG - Intergenic
1016362648 6:143285083-143285105 GGGGGATTAAGTACAATTGAGGG - Intronic
1016502031 6:144732361-144732383 GGCTGAGAATGTGGAATTAATGG - Intronic
1017192638 6:151670099-151670121 GGGGGAGAATGGAGGAGTTACGG - Intronic
1017225322 6:152014595-152014617 GAGGGAGAAGGTAGAATCCATGG - Intronic
1017495493 6:154979592-154979614 TGGGGAGAATCCTGAATTGACGG + Intronic
1017511937 6:155122302-155122324 GGGAGGGAATGCAGAATGGAAGG + Intronic
1017511948 6:155122341-155122363 GGGAGGGAATGGAGAATGGAAGG + Intronic
1017511958 6:155122380-155122402 GGGAGGGAATGCAGAATGGAAGG + Intronic
1017511989 6:155122497-155122519 GGGAGGGAATGGAGAATGGATGG + Intronic
1020269978 7:6589299-6589321 GGGGGAGAGAGGAGAATAGAGGG - Exonic
1020700467 7:11475504-11475526 GTGGGAGAATGGGGAAGTGATGG + Intronic
1020913637 7:14165047-14165069 GGGGCAGAAAATAGAAATGAGGG - Intronic
1020964643 7:14849719-14849741 GGAGGAGAATGGAGATTTGGAGG - Intronic
1021903906 7:25314437-25314459 GTGGGAGAATGGAGAATGGAGGG + Intergenic
1022188056 7:27988336-27988358 GGGGGAAAATGTAGAGATGTGGG - Intronic
1022311439 7:29200314-29200336 GGGGAAGAATGGAGAAAGGAAGG - Intronic
1024198779 7:47086141-47086163 AGGGGAGAAGGTAGAATGAAGGG + Intergenic
1024720633 7:52133967-52133989 GGAGGAGAAAGTAGAAGTGCAGG + Intergenic
1024857857 7:53802187-53802209 GGGTGGGAATGTAGAATCAAAGG - Intergenic
1025840864 7:65146951-65146973 GGAGAAGGATGTAGAATTGTTGG - Intergenic
1025877850 7:65503333-65503355 GGAGAAGGATGTAGAATTGTTGG + Intergenic
1025882184 7:65549041-65549063 GGAGAAGGATGTAGAATTGTTGG + Intergenic
1025891258 7:65653590-65653612 GGAGAAGGATGTAGAATTGTTGG - Intergenic
1027152087 7:75739666-75739688 GGGGCAGAATGGAGAAGTGCAGG - Intergenic
1027519946 7:79193710-79193732 GGGGGAGAAAGTACTATTAAAGG - Intronic
1027598773 7:80211858-80211880 GGGGGAAAAAGTAGAAATGTCGG + Intronic
1034535015 7:151721003-151721025 GGAGGAGAATGAAGAACAGAGGG + Intronic
1037333960 8:17773993-17774015 AGGAGAGAATGTAGATGTGAGGG - Intronic
1042310490 8:67374522-67374544 GGTGGGGAATGAAGAGTTGATGG + Intergenic
1042385661 8:68170715-68170737 GGGTGAGAATGGTGAATGGAGGG - Intronic
1042577335 8:70234956-70234978 GGGTGTGGAGGTAGAATTGATGG - Intronic
1045338735 8:101233010-101233032 GGGGGAGAAAGTAGAGGTGGAGG + Intergenic
1046953565 8:120041076-120041098 GAAGGAGAATGAAGGATTGAAGG - Intronic
1047975118 8:130122093-130122115 TGGGGAAAGTGCAGAATTGAGGG - Intronic
1048245888 8:132798614-132798636 GAGGGAGAAAGTAAACTTGATGG + Intronic
1048876560 8:138841042-138841064 GAGGGAGAAAGAAGAATGGAAGG - Intronic
1049182053 8:141227933-141227955 GTGGGAGAATCTGGCATTGAAGG + Intronic
1049283401 8:141761962-141761984 GGGAGGGAATGAAGAATTAAAGG - Intergenic
1051370512 9:16355263-16355285 AGGGGAGGAAGTAGGATTGATGG - Intergenic
1052034870 9:23669134-23669156 GGGGCAGAATCTAGAAGTAAAGG + Intergenic
1053141306 9:35684596-35684618 GGGGTACAATGGAGAAATGAAGG - Intronic
1055412002 9:76040601-76040623 GAGGAAGAAAGTAAAATTGAAGG + Intronic
1055703451 9:78971811-78971833 GAGGGAGAATGGAGAAAAGAAGG + Intergenic
1056641324 9:88373456-88373478 TGGGGGGAATGGGGAATTGAGGG - Intergenic
1057016207 9:91655204-91655226 GGAGGAGAATGAAGATGTGAAGG + Intronic
1057077207 9:92144247-92144269 GTGGGTGAGTGTAGAATTCAAGG + Intergenic
1059797335 9:117712906-117712928 CTGGGAGAATTTAGAAATGAAGG + Exonic
1060396844 9:123322248-123322270 GGGGGAGAATGGTGAGTTCATGG - Intergenic
1062001299 9:134217052-134217074 GAGGGAGAATGAAGGAATGAAGG + Intergenic
1062223022 9:135429777-135429799 GGAAGAGAATGTAAAATTCATGG + Intergenic
1062386092 9:136312075-136312097 CGGAGAGGATGTAGAAATGAGGG - Intergenic
1186607622 X:11108541-11108563 GTGGGAGAAGGGAGAATTGCGGG + Intergenic
1187550349 X:20296703-20296725 GGGAAAGAATGGAGAATTGTTGG + Intergenic
1188316820 X:28685020-28685042 TTGGGAGACTGAAGAATTGATGG + Intronic
1189134429 X:38534006-38534028 GTGGGAAAATGTAGCATTTAAGG - Intronic
1189267678 X:39729433-39729455 GGAGGAGAATGGGGAAGTGAAGG + Intergenic
1189860325 X:45264874-45264896 GAGAGAAAAAGTAGAATTGAGGG - Intergenic
1190069635 X:47269135-47269157 GCTGAAGAATTTAGAATTGAAGG + Intergenic
1190752082 X:53371205-53371227 GGGGCAAAAAGTAGACTTGATGG + Intergenic
1192142168 X:68655014-68655036 GGGGGAGTATAGAGAATTCAGGG + Intronic
1196023928 X:111020398-111020420 AGGGGAGAATGGGGAATTGTTGG + Intronic
1197226552 X:123961113-123961135 GGGGGAGAAGGGAGAAAGGAGGG - Intronic
1199389375 X:147262013-147262035 GGGGGATAATGTTGCTTTGAGGG + Intergenic