ID: 986827023

View in Genome Browser
Species Human (GRCh38)
Location 5:11532881-11532903
Sequence CAGGAGAAAAAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3489
Summary {0: 1, 1: 0, 2: 34, 3: 369, 4: 3085}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986827016_986827023 11 Left 986827016 5:11532847-11532869 CCCAGAAAAGGGTTACTTGTTGT 0: 1
1: 0
2: 1
3: 10
4: 159
Right 986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG 0: 1
1: 0
2: 34
3: 369
4: 3085
986827013_986827023 20 Left 986827013 5:11532838-11532860 CCTATGGCCCCCAGAAAAGGGTT 0: 1
1: 0
2: 0
3: 8
4: 111
Right 986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG 0: 1
1: 0
2: 34
3: 369
4: 3085
986827017_986827023 10 Left 986827017 5:11532848-11532870 CCAGAAAAGGGTTACTTGTTGTT 0: 1
1: 0
2: 2
3: 11
4: 164
Right 986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG 0: 1
1: 0
2: 34
3: 369
4: 3085
986827015_986827023 12 Left 986827015 5:11532846-11532868 CCCCAGAAAAGGGTTACTTGTTG 0: 1
1: 0
2: 1
3: 26
4: 252
Right 986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG 0: 1
1: 0
2: 34
3: 369
4: 3085
986827014_986827023 13 Left 986827014 5:11532845-11532867 CCCCCAGAAAAGGGTTACTTGTT 0: 1
1: 0
2: 1
3: 35
4: 245
Right 986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG 0: 1
1: 0
2: 34
3: 369
4: 3085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986827023 Original CRISPR CAGGAGAAAAAGAAGGAGGG AGG Intronic
Too many off-targets to display for this crispr