ID: 986830334

View in Genome Browser
Species Human (GRCh38)
Location 5:11570001-11570023
Sequence TAGTATGTGCATCTTGTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986830334 Original CRISPR TAGTATGTGCATCTTGTCTT AGG (reversed) Intronic
902143330 1:14375481-14375503 TAGTATGAGCATCTTGCCTGTGG - Intergenic
902338777 1:15769037-15769059 TCGTATGTGCATAGTGTCTTTGG - Intronic
914406330 1:147377412-147377434 TAGGATGTGCATTTTGTTTGTGG - Intergenic
914455384 1:147832010-147832032 TACTTTGTGCTTCTTGTATTTGG + Intergenic
920694538 1:208172180-208172202 CAATATGTGCATCTTTCCTTTGG - Intronic
920954307 1:210603597-210603619 GAGTATGTGCATATTATTTTAGG - Intronic
922600790 1:226851132-226851154 TAGCATGGCCATCTTGTTTTTGG - Intergenic
1063656855 10:7999263-7999285 TAAGATTTGTATCTTGTCTTTGG - Intronic
1067550690 10:47233534-47233556 CAGTTTGTGCAGCTTGCCTTTGG + Intergenic
1069332890 10:67314095-67314117 AATTATGTGCATCTTCTTTTTGG - Intronic
1069910571 10:71756537-71756559 GAGTATGTGCATTTTCTTTTAGG + Intronic
1074687862 10:115976473-115976495 CAGTGTGTGCATCTTGCCCTTGG + Intergenic
1077199678 11:1299669-1299691 CAGTATGTGCATCTTGTACATGG - Intronic
1080168377 11:29268498-29268520 TAGTATTTACATCTTCACTTAGG + Intergenic
1080333726 11:31172959-31172981 TTATATGTGCATCATTTCTTTGG - Intronic
1080571282 11:33559349-33559371 TGGTATGTGTATCTTTTCCTGGG - Intronic
1081231743 11:40592830-40592852 TACTGGGTGTATCTTGTCTTTGG + Intronic
1081711259 11:45217448-45217470 CAGAATTTGCATCTTGTCCTAGG - Intronic
1082761318 11:57129888-57129910 TTGTATTTGAACCTTGTCTTTGG + Intergenic
1083057453 11:59836317-59836339 TATTAATTGCTTCTTGTCTTAGG + Intronic
1086839854 11:91671702-91671724 TAGTATGTGAATAATGTCATTGG - Intergenic
1092406064 12:8222853-8222875 TGGCGTGTGCACCTTGTCTTTGG - Intronic
1095892963 12:47251549-47251571 TTCTATGTGCTTCTTGTATTTGG - Intergenic
1096315836 12:50564746-50564768 TAGTATGTTAATTTTGTCATTGG + Intronic
1096494596 12:52032746-52032768 TAGTTTTTGCACCTTTTCTTAGG + Intronic
1096956993 12:55535980-55536002 TTCTTTGTGCATCTTGTATTTGG - Intergenic
1097760751 12:63460964-63460986 TTGTTTGTGCTTCTTGTATTTGG - Intergenic
1101538820 12:105645713-105645735 TACTATGTCCCTCTTGCCTTGGG - Intergenic
1102650857 12:114441363-114441385 TAGGATGTGTATATTGTGTTAGG + Intergenic
1103397097 12:120616432-120616454 TGTTATGTGAATCTTGTCTCAGG - Intergenic
1104324001 12:127778596-127778618 TAGGATAGGCATTTTGTCTTTGG + Intergenic
1105595643 13:21835114-21835136 TAGGATGTGTAACTTTTCTTGGG - Intergenic
1106262750 13:28082281-28082303 TGGTATGTGCATGTAGTCCTAGG - Intronic
1107365768 13:39673013-39673035 TGGTATTTGCATATTTTCTTTGG + Intronic
1108358590 13:49649944-49649966 TAAAATGTGCAGCTTGCCTTGGG - Intergenic
1108535857 13:51377165-51377187 TTGTATTTGCATATTTTCTTTGG + Intronic
1108558052 13:51615289-51615311 TACTATCTGTATGTTGTCTTTGG - Intronic
1109090628 13:58039793-58039815 TATCATCTGCATATTGTCTTTGG - Intergenic
1110225692 13:73117334-73117356 GAGAATGGGCCTCTTGTCTTTGG + Intergenic
1111032519 13:82622623-82622645 TAGTTTGTGCAAATTCTCTTAGG + Intergenic
1112233605 13:97613970-97613992 TTTTATGTGCTTCTTGGCTTGGG - Intergenic
1112867063 13:103917016-103917038 TAGTATTTTCTTCTTGCCTTGGG - Intergenic
1115993302 14:39171315-39171337 TAGTATGTACATCTTAAATTTGG + Intergenic
1117397391 14:55324185-55324207 TAGTATGTGCCTTTTGTTTCTGG + Intronic
1117511710 14:56458291-56458313 AATTATGTGCTTTTTGTCTTTGG - Intergenic
1118531048 14:66705551-66705573 AATTATGTGCGTTTTGTCTTTGG - Intronic
1124217856 15:27824413-27824435 TATTTTGTGCATCATGTCATAGG - Intronic
1129070623 15:72947080-72947102 TAGTCTGTGTATGATGTCTTTGG - Intergenic
1129688438 15:77699497-77699519 TAGTATGTGCTTATTGTGTGTGG - Intronic
1129688454 15:77699713-77699735 TAGTATGTGCTTATTGTGTGTGG - Intronic
1135418579 16:22288525-22288547 AAGTATATGCAGCTTGTTTTGGG + Exonic
1135752143 16:25066428-25066450 TAGTACGTTCATTTTGTCTAGGG - Intergenic
1137315418 16:47315490-47315512 TAATATGAGCATTTTGTCATTGG - Intronic
1137927166 16:52550892-52550914 TAGTATTTGCATCTGATCTTGGG - Intergenic
1138974850 16:62192104-62192126 TAAGATTTGCTTCTTGTCTTTGG - Intergenic
1138976672 16:62215965-62215987 GAGTACATGCATCTTTTCTTTGG + Intergenic
1153155722 18:2146613-2146635 TAGTATGTGCTTGTAGTCCTAGG - Intergenic
1153913336 18:9722966-9722988 TAGTATCTGCATCTAGTCATGGG - Intronic
1158348252 18:56537814-56537836 TACTATGATCATCATGTCTTTGG - Intergenic
1159127082 18:64236277-64236299 TGGTATATCCATCTTATCTTTGG + Intergenic
1159439211 18:68455975-68455997 TATGATGGCCATCTTGTCTTTGG - Intergenic
1159761685 18:72434698-72434720 GCGTATGTGCATCTTGTTTCGGG - Intergenic
1162579304 19:11518764-11518786 TAGTATGTGCCTGTAGTCCTGGG + Intronic
1164490252 19:28704631-28704653 TTGTATGTGCATTTTGTGCTGGG - Intergenic
1165574938 19:36807390-36807412 GAGTATGTGCATCTTGGCAGAGG + Intergenic
925573527 2:5336409-5336431 AAGTATGTGGAACTTGTCTTTGG - Intergenic
926994707 2:18722012-18722034 TGGTATGTGCACCTTATTTTAGG - Intergenic
929688109 2:44051986-44052008 AATTATGTGCATCTTGTGTGTGG + Intergenic
932100464 2:68895121-68895143 TTCTTTGTGCATCTTGTATTTGG + Intergenic
933366374 2:81359221-81359243 AAGAATGTGGATTTTGTCTTTGG + Intergenic
942000662 2:171643532-171643554 TAATATGTGGTTTTTGTCTTTGG + Intergenic
942716707 2:178901492-178901514 TATCATGTGCTTTTTGTCTTTGG - Intronic
943445105 2:187975269-187975291 GAGTATGTGTATCTTTTCTGAGG + Intergenic
944008892 2:194946842-194946864 CAGTGTGTGCATATTGCCTTAGG - Intergenic
944797431 2:203202282-203202304 TAGTATGTGCAGTTTTTCTAAGG + Intronic
945911384 2:215653779-215653801 TAGTGTGTGGATCTTATGTTGGG - Intergenic
948157742 2:235797923-235797945 CACTATTTGCATATTGTCTTTGG - Intronic
948872033 2:240806086-240806108 TAGTATGTGCCCCTTCTCTCAGG - Intronic
1169176112 20:3515913-3515935 TAGTACGTGCATTTAGTCATGGG + Intronic
1169677004 20:8165685-8165707 AAGGCTGTGCATCTTGTCTAAGG + Intronic
1171442107 20:25173453-25173475 TAGAATGTGCTGATTGTCTTTGG - Intergenic
1172261478 20:33569924-33569946 TGGTGTGTGCCTCTTGTCTCAGG + Intronic
1174986870 20:55464339-55464361 TAGTCTATGAATCATGTCTTTGG + Intergenic
1175896931 20:62341138-62341160 TAGTTTCTGCCTTTTGTCTTTGG - Intronic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1177686104 21:24439304-24439326 TAATATGTGCAACATGTTTTTGG + Intergenic
1178843193 21:36154947-36154969 TTGTATGTGCATGGTGGCTTTGG + Intergenic
1182405447 22:30125012-30125034 GTGTTTGTGCATCTTTTCTTTGG + Intronic
950897287 3:16464725-16464747 TAAAATGTGCATATTGTCTATGG + Intronic
951331349 3:21372565-21372587 GAGTACAAGCATCTTGTCTTGGG - Intergenic
951769171 3:26236026-26236048 TAGTATGTGCATAGTGTTCTAGG + Intergenic
952222576 3:31340005-31340027 TAGTATGTGAGTGGTGTCTTGGG + Intergenic
953180815 3:40593410-40593432 GAGTCTGAGTATCTTGTCTTTGG + Intergenic
957924704 3:86793575-86793597 ATGTATGTGCATTTTGACTTTGG - Intergenic
959302911 3:104625171-104625193 TTGTAGGTCCATCTTGCCTTTGG + Intergenic
960360732 3:116707712-116707734 TAGATTGTGCATGTTGTCATGGG + Intronic
960647533 3:119904417-119904439 TGGTATTTGCATCTTCTTTTTGG - Intronic
962214605 3:133510498-133510520 GACTATGTGCACCTTGCCTTTGG - Intergenic
962431031 3:135320055-135320077 AATTATGTCCATCTTGTCTCTGG + Intergenic
962509071 3:136080397-136080419 TAGTATGTGCATTTTTAATTTGG + Intronic
962822956 3:139070327-139070349 TGTTATGTGCTTCTTTTCTTTGG + Intronic
962829344 3:139126312-139126334 CAGTATGTGGACCTGGTCTTGGG + Intronic
963057471 3:141198331-141198353 AATTATGTGCTTTTTGTCTTTGG - Intergenic
964969417 3:162541782-162541804 TAGTAAGTTCATTTTGTCTGTGG + Intergenic
966087610 3:176088179-176088201 GAGTATGTGCAGCTTCTCTAGGG + Intergenic
966570698 3:181439924-181439946 TAGTATGTGCCTGATGTATTAGG + Intergenic
967058672 3:185852134-185852156 TAGTCTGTGCACCTTGATTTGGG + Intergenic
967185927 3:186944534-186944556 TAGTTTCATCATCTTGTCTTTGG - Intronic
967497424 3:190156974-190156996 TAGTATTTGCATAATGTTTTTGG - Intergenic
967612321 3:191521893-191521915 TAGTTTCTGCATATTCTCTTGGG - Intergenic
968245332 3:197140522-197140544 AAGTATGTGCAACTTGTCGTTGG + Intronic
971837751 4:31790773-31790795 TAGTATCTGCTTCTGTTCTTTGG - Intergenic
974097673 4:57382672-57382694 TAGAATATTCATCTGGTCTTTGG - Intergenic
975947828 4:79729187-79729209 TAGTATATGCATCATGGCATAGG + Intergenic
977911646 4:102544114-102544136 ATGTATGTGCATTTTTTCTTGGG + Intronic
978664653 4:111167923-111167945 TAATATGTGGTTTTTGTCTTTGG - Intergenic
981097468 4:140796649-140796671 TAGTACATGCATATTGTCTAGGG - Intergenic
982798359 4:159672421-159672443 TTGTATTTGCTTTTTGTCTTTGG + Intergenic
983794350 4:171842054-171842076 TAGTAATTGAATTTTGTCTTTGG + Intronic
984032827 4:174625955-174625977 TAGTTTGTGTTTCCTGTCTTCGG + Intergenic
986830334 5:11570001-11570023 TAGTATGTGCATCTTGTCTTAGG - Intronic
992703363 5:79362893-79362915 TGAGATGTCCATCTTGTCTTTGG + Intergenic
993917204 5:93757355-93757377 TTCTTTGTGCATCTTGTATTTGG - Intronic
993969992 5:94407583-94407605 CAGTATGTGCATTTTGTGTCCGG - Intronic
997389858 5:133505473-133505495 TAGGAAGAGAATCTTGTCTTCGG - Intronic
997552901 5:134769232-134769254 TAGTATGTTCAGTTTTTCTTGGG + Intronic
999877318 5:155822192-155822214 TAATATGTGTTTCATGTCTTAGG - Intergenic
1002366315 5:178715166-178715188 TAGTCTTAGCATCTTCTCTTGGG + Intronic
1003451040 6:6231554-6231576 TTGTTTGTGCTTCTTGTATTTGG - Intronic
1004817774 6:19331327-19331349 TAATATGTGCATTTGGTATTGGG - Intergenic
1007441731 6:41867143-41867165 TAGTATGTGGTTTTTGTTTTGGG - Intronic
1008271558 6:49495855-49495877 TTTTATTTGGATCTTGTCTTGGG - Intergenic
1011719796 6:90143668-90143690 TAGAATGTGCTTCTCCTCTTTGG + Intronic
1012439562 6:99250847-99250869 TAGTTGGTGCCTATTGTCTTGGG - Intergenic
1012494781 6:99822100-99822122 GAGGATATGCATCTTGTCATTGG - Intergenic
1014854288 6:126380557-126380579 TAGCATGTGAATCTTGTCTCTGG + Intergenic
1014893378 6:126870090-126870112 TTGTATCTGCATGTTGTATTTGG - Intergenic
1015370419 6:132444702-132444724 TAATATGTGCTGCTTTTCTTTGG - Intergenic
1015834124 6:137401118-137401140 TAGAATGTGCATCTTGAATAAGG - Intergenic
1015940004 6:138440072-138440094 GTGTATGTGCATCTTTACTTGGG + Intronic
1018614333 6:165672308-165672330 TATTAAGTGCATTTTGACTTAGG - Intronic
1019078337 6:169409940-169409962 AGTTATGTGCATGTTGTCTTAGG + Intergenic
1021158861 7:17246869-17246891 TAGTTTCTGCGGCTTGTCTTGGG - Intergenic
1024436195 7:49357767-49357789 TGGTATATTCATCCTGTCTTTGG - Intergenic
1024545650 7:50515042-50515064 TTGTTTGTGCTTCTTGTATTTGG - Intronic
1024579696 7:50792404-50792426 TATTGTGTGCGTCTTTTCTTGGG - Intronic
1024772819 7:52744601-52744623 TAGGATGGGCATCTGATCTTGGG - Intergenic
1025772928 7:64529775-64529797 TTCTTTGTGCATCTTGTATTTGG - Intronic
1028096124 7:86763361-86763383 TAATACGTTCATCTTATCTTGGG + Intronic
1028993309 7:97074007-97074029 TTCTTTGTGCATCTTGTATTTGG + Intergenic
1030080042 7:105769620-105769642 TAGAATGACCATCTTGTCCTGGG - Intronic
1030253584 7:107480680-107480702 TAGTATGTGCAGCCTGTCAATGG - Intronic
1032466494 7:132148951-132148973 TATTATGTGCCTCTTTTGTTTGG - Intronic
1033506850 7:142011924-142011946 TAATATGTGCATCTTGAGTCAGG - Intronic
1034753729 7:153594825-153594847 TAGAATGTGTATCTTGGTTTAGG - Intergenic
1036001582 8:4610967-4610989 TAGTATCTGCATCCTTTCCTTGG + Intronic
1036263680 8:7258861-7258883 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036264981 8:7266483-7266505 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036266282 8:7274105-7274127 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036267583 8:7281727-7281749 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036268886 8:7289349-7289371 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036270184 8:7296971-7296993 TGGTGTGTGCACCTTGTCTTTGG + Intergenic
1036297704 8:7550083-7550105 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036299008 8:7557731-7557753 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036300313 8:7565381-7565403 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036301619 8:7573026-7573048 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036302917 8:7580675-7580697 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036315721 8:7717400-7717422 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036317030 8:7725048-7725070 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036318337 8:7732696-7732718 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036319646 8:7740343-7740365 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036320953 8:7747991-7748013 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036322263 8:7755639-7755661 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036323572 8:7763287-7763309 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036324868 8:7770935-7770957 TGGCGTGTGCACCTTGTCTTTGG + Intergenic
1036351168 8:8013373-8013395 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036352474 8:8021019-8021041 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036353767 8:8028667-8028689 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036846447 8:12173792-12173814 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1036867810 8:12416111-12416133 TGGCGTGTGCACCTTGTCTTTGG - Intergenic
1039944748 8:42119631-42119653 TGGTCTGTGCATCTTCTGTTTGG - Intergenic
1042836445 8:73083115-73083137 TAGTATTTGTTTCTTGTATTCGG + Intronic
1043465679 8:80504641-80504663 CAGTATGTGCATATTCTCTTAGG - Intronic
1045779973 8:105850985-105851007 TTGTTTGTGCTTCTTGTATTCGG - Intergenic
1046198474 8:110892471-110892493 TTGTCTTTGCATCTTGTCATTGG - Intergenic
1049172080 8:141167675-141167697 TAGCAGGTACATCTTGGCTTAGG + Intronic
1050667226 9:7953308-7953330 TAGTACATGCATCTTGTTTTGGG - Intergenic
1050915456 9:11124951-11124973 TAGTATATGCATTTTTTTTTTGG + Intergenic
1051296052 9:15597400-15597422 TAATATGTGGTTTTTGTCTTTGG + Intronic
1052305776 9:27007590-27007612 TACTATGTTCATCTTTTATTTGG + Intronic
1056435507 9:86572110-86572132 TTGTATTTGCATCTTTCCTTTGG + Intergenic
1056841579 9:90002299-90002321 TTGTATGTTCATCTTGGCTTGGG - Intergenic
1058539343 9:105995334-105995356 TAATATGTGCATCTTGTTTTAGG + Intergenic
1186662653 X:11684718-11684740 TAGTCTTTGCATCTTATATTCGG + Intergenic
1187135435 X:16543078-16543100 TACTTTGTGTATCTTGTCTAGGG - Intergenic
1188027332 X:25223960-25223982 TATTATCTGCTTCTTGACTTTGG + Intergenic
1189523724 X:41798132-41798154 ATGTATGTGGATATTGTCTTTGG + Intronic
1189685597 X:43560586-43560608 TAGTAGCTGCTTCTAGTCTTGGG + Intergenic
1190431346 X:50380540-50380562 TAGTATATGGATCTGGTGTTTGG - Intronic
1191009548 X:55746388-55746410 TACTATGACCACCTTGTCTTTGG + Intronic
1191832902 X:65434072-65434094 AAGTATGCCAATCTTGTCTTTGG + Intronic
1195326600 X:103763530-103763552 AAGTATGTGCATCTGGTGTGAGG + Intergenic
1196985039 X:121260040-121260062 AAATATGTGGCTCTTGTCTTTGG + Intergenic
1197476173 X:126928454-126928476 TTCTTTGTGCTTCTTGTCTTTGG + Intergenic
1201929368 Y:19324819-19324841 TTGTAAATCCATCTTGTCTTTGG + Intergenic