ID: 986830416

View in Genome Browser
Species Human (GRCh38)
Location 5:11571378-11571400
Sequence TTATGCACAAAGCTGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986830416_986830423 25 Left 986830416 5:11571378-11571400 CCTAGCTCCAGCTTTGTGCATAA 0: 1
1: 0
2: 1
3: 12
4: 187
Right 986830423 5:11571426-11571448 AGCTAAGCAAGATTGAGGAGGGG No data
986830416_986830424 28 Left 986830416 5:11571378-11571400 CCTAGCTCCAGCTTTGTGCATAA 0: 1
1: 0
2: 1
3: 12
4: 187
Right 986830424 5:11571429-11571451 TAAGCAAGATTGAGGAGGGGTGG 0: 1
1: 0
2: 0
3: 33
4: 297
986830416_986830421 23 Left 986830416 5:11571378-11571400 CCTAGCTCCAGCTTTGTGCATAA 0: 1
1: 0
2: 1
3: 12
4: 187
Right 986830421 5:11571424-11571446 AAAGCTAAGCAAGATTGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 234
986830416_986830422 24 Left 986830416 5:11571378-11571400 CCTAGCTCCAGCTTTGTGCATAA 0: 1
1: 0
2: 1
3: 12
4: 187
Right 986830422 5:11571425-11571447 AAGCTAAGCAAGATTGAGGAGGG 0: 1
1: 0
2: 2
3: 21
4: 238
986830416_986830425 29 Left 986830416 5:11571378-11571400 CCTAGCTCCAGCTTTGTGCATAA 0: 1
1: 0
2: 1
3: 12
4: 187
Right 986830425 5:11571430-11571452 AAGCAAGATTGAGGAGGGGTGGG 0: 1
1: 0
2: 2
3: 31
4: 404
986830416_986830420 20 Left 986830416 5:11571378-11571400 CCTAGCTCCAGCTTTGTGCATAA 0: 1
1: 0
2: 1
3: 12
4: 187
Right 986830420 5:11571421-11571443 CGCAAAGCTAAGCAAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986830416 Original CRISPR TTATGCACAAAGCTGGAGCT AGG (reversed) Intronic
900820132 1:4880072-4880094 TTATGCACCATCATGGAGCTTGG + Intergenic
903305543 1:22410369-22410391 ATATGGACAGAGCTGGAGATTGG + Intergenic
905792189 1:40795813-40795835 GAATGCACGAAGCTGGAGCCAGG + Intronic
908541157 1:65123358-65123380 ATATGCAGAAAGCTGAAACTGGG - Intergenic
908648288 1:66303639-66303661 TTATGCAAATAGCTAGAGTTTGG - Intronic
908829570 1:68165596-68165618 ATATGAACAGAGCTTGAGCTCGG + Intronic
909307752 1:74102875-74102897 TTATCCACATATATGGAGCTAGG + Intronic
911780054 1:101865175-101865197 TAATGCTCAAAACTGGAGCAGGG - Intronic
917982578 1:180280393-180280415 TTAGGTACAAAGCAGGAGGTTGG + Intronic
919758531 1:201081680-201081702 TAATTCCCAATGCTGGAGCTGGG + Intronic
921124554 1:212165857-212165879 ATATTCACAAAGCAGGATCTAGG + Intergenic
922170695 1:223152002-223152024 TAATCCACAAATCTGGAGGTGGG + Intergenic
923304441 1:232675203-232675225 TTGGGTACAAAGCAGGAGCTAGG + Intergenic
924948551 1:248862777-248862799 TCATGCAAATACCTGGAGCTGGG - Intergenic
1063072691 10:2682024-2682046 TTTTGCACAAAGACAGAGCTGGG + Intergenic
1063767322 10:9157612-9157634 TTATGCACAGACCTGCAGTTTGG - Intergenic
1068016527 10:51523923-51523945 TAATCCCCAAAGCTGGAGATGGG + Intronic
1069381163 10:67844269-67844291 TAATCCCCAATGCTGGAGCTAGG + Intergenic
1070722098 10:78764065-78764087 TTATCCACACAGATGGGGCTGGG - Intergenic
1072914573 10:99530155-99530177 TTATGCCCAGAGCAGGAGTTTGG - Intergenic
1073603767 10:104872523-104872545 TTATTCAGAAAGTTGGAGATGGG + Intronic
1075915513 10:126162877-126162899 TAATCCCCAAAGCTGGAGGTGGG + Intronic
1077800671 11:5532967-5532989 TGATGTAGAAAGCTGGGGCTTGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1080160227 11:29165500-29165522 TTGAGGACCAAGCTGGAGCTTGG + Intergenic
1087016412 11:93558474-93558496 TTAGGGACAAAGGTGTAGCTGGG + Intergenic
1089040141 11:115440382-115440404 CTATGCACAATGCTGGAGATTGG - Intronic
1090005176 11:122995972-122995994 TTAGGAACAAAGCTGAAGTTAGG + Intergenic
1091713507 12:2759931-2759953 TTCTTCACCAAGCTGAAGCTTGG - Intergenic
1093184344 12:16002873-16002895 TTCAGCACAAAGCTGGGGCAGGG - Intronic
1096202865 12:49698247-49698269 TTATGGCCAAAACTGGAGTTGGG - Intronic
1096750489 12:53755904-53755926 TTATCCAAAAAACTGGTGCTGGG - Intergenic
1097913482 12:64995391-64995413 TCACCAACAAAGCTGGAGCTCGG - Intergenic
1098913299 12:76232200-76232222 TCAAGGACAAAGCTGGTGCTGGG + Intergenic
1099055302 12:77833057-77833079 TTATGAATAAAGTTGGATCTGGG - Intronic
1100487785 12:95047262-95047284 TTATGGACAAGGGTGGAGCAAGG - Intronic
1102755510 12:115336313-115336335 TCATGCACGATGCTGGAGTTTGG + Intergenic
1108256181 13:48613220-48613242 TTATGCAGAAATGTGGAGATGGG + Intergenic
1110287451 13:73766192-73766214 TTATGCAGAAAGATGGAGAGAGG + Intronic
1111503821 13:89160173-89160195 TTATGAACAAAGCAGAAACTCGG - Intergenic
1112362998 13:98733846-98733868 TAATCCCCAAAGCTGGAGGTGGG + Intronic
1113499509 13:110762011-110762033 TTATCCACTCAGCTGGGGCTTGG - Intergenic
1113968956 13:114173852-114173874 TGTTGCACAGAGCTGGAGCTGGG - Intergenic
1117774648 14:59170515-59170537 TTATGAACAATGCTGGAGCCAGG - Intergenic
1120047813 14:79828091-79828113 TAATCCCCAAAGCTGGAGGTGGG - Intronic
1121948323 14:98144953-98144975 TTATGCACACAGTAGGTGCTTGG + Intergenic
1125878813 15:43174213-43174235 TTATACACAAATTTGGTGCTGGG - Intronic
1127387587 15:58479077-58479099 TAATGAACAAAGCAGCAGCTAGG - Intronic
1128130571 15:65224646-65224668 ATTTGCACAAAGCTGGTGATTGG - Intergenic
1128546565 15:68572611-68572633 TGATTCAGAAACCTGGAGCTGGG - Intergenic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1129271191 15:74420097-74420119 TTTTGGTCAGAGCTGGAGCTTGG - Intronic
1129882012 15:79013214-79013236 TTACATACAAAGCTGGGGCTGGG + Intronic
1130037755 15:80377130-80377152 ATATTCACAAAGCTGGAGGAGGG - Exonic
1130894567 15:88160152-88160174 TGAGACCCAAAGCTGGAGCTGGG + Intronic
1131322694 15:91410388-91410410 AACTGCTCAAAGCTGGAGCTTGG - Intergenic
1131575048 15:93580392-93580414 TGATCCACAATGCTGGAGGTGGG - Intergenic
1133396268 16:5449906-5449928 ATATGTACAAAGCTAGAGGTGGG - Intergenic
1135569297 16:23535992-23536014 TTCTGCACAAGGCTGGAGGTGGG - Intronic
1137291168 16:47052994-47053016 TTCTACACAAAGCGGGTGCTGGG - Intergenic
1139570869 16:67811196-67811218 TTATCCAAAAAGCTTGGGCTTGG - Intronic
1139911015 16:70397837-70397859 TGCTGCACAAGGCTGGATCTGGG - Intronic
1140607719 16:76561590-76561612 TGATTAAGAAAGCTGGAGCTTGG + Intronic
1140916642 16:79499727-79499749 TTTTGCACAGTTCTGGAGCTGGG - Intergenic
1142855983 17:2730739-2730761 CCAGGCTCAAAGCTGGAGCTGGG - Intergenic
1143967535 17:10767530-10767552 TTATGCTCAAAGCAGCTGCTGGG + Intergenic
1146507567 17:33418564-33418586 ATATGCAGAAAGCTGAAACTGGG - Intronic
1152795678 17:82305013-82305035 TTAGGAGCAAAGCTGGAGCCAGG - Intergenic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1159523419 18:69556427-69556449 TTATGCACAAGGATGGAGAAGGG - Intronic
1159607171 18:70487061-70487083 TTATCCCCAAGGCTGGAGGTGGG + Intergenic
1163572028 19:18087961-18087983 AGGTGCACAAGGCTGGAGCTTGG - Intronic
1166144367 19:40824061-40824083 TTATACCCAGAGGTGGAGCTTGG + Intronic
1167703383 19:51064672-51064694 TTAGGCACAAAGCAGCTGCTAGG + Intronic
925283040 2:2698185-2698207 ATATCCACAAAACTGGAACTAGG - Intergenic
925634364 2:5928456-5928478 TTATTCACAAATCTGCAGTTGGG + Intergenic
926444478 2:12926456-12926478 TAATCCTCAAAGCTGGAGGTGGG - Intergenic
929090810 2:38215446-38215468 TTCTGCAAAACGATGGAGCTTGG + Intergenic
929569986 2:43016589-43016611 TGATCCCCAAAGCTGGAGGTGGG + Intergenic
929649973 2:43668918-43668940 TTATGCACAAAGGTGGGGGAAGG + Intronic
930104874 2:47631940-47631962 TTCAGAACAAAGCTGGTGCTGGG + Intergenic
933169744 2:79111811-79111833 TTATACTAAAAGCTGGACCTTGG - Intergenic
935142710 2:100368095-100368117 TGTTGCACTAACCTGGAGCTTGG - Intergenic
936728720 2:115355751-115355773 ATATGCAGAAAGCTGAAACTGGG - Intronic
936974831 2:118208378-118208400 TTAGCCACAAAGTAGGAGCTGGG + Intergenic
940582695 2:155601314-155601336 TTCTGCACAAAGCTGGTACTGGG + Intergenic
944680842 2:202075230-202075252 TTATTCCCAAAGCTGCAACTGGG - Intronic
944861742 2:203821791-203821813 ACATTCATAAAGCTGGAGCTGGG - Intergenic
945836340 2:214839802-214839824 TGATCCCCAATGCTGGAGCTGGG - Intergenic
946010282 2:216558928-216558950 TTATGCCCAAAGCTAGAGAGTGG - Intronic
946217320 2:218194687-218194709 TCAGGGACATAGCTGGAGCTGGG - Intergenic
947811465 2:233006886-233006908 TTAAGCACTTTGCTGGAGCTGGG - Intronic
948738194 2:240024987-240025009 TTAAGCAAAACGCTGGAGCGCGG - Intronic
1170372714 20:15667100-15667122 TAATCCCCAAAGCTGGAGGTGGG + Intronic
1171881901 20:30623316-30623338 TTATGCAGAAAACTGAAACTGGG - Intergenic
1173795143 20:45854669-45854691 TTATGGACAAAACTGAAGCTAGG + Intronic
1175832826 20:61976461-61976483 GTAGGCCCACAGCTGGAGCTGGG + Intronic
1176602237 21:8803963-8803985 TTATGCAGAAAACTGAAACTGGG - Intergenic
1180344523 22:11695514-11695536 TTATGCAGAAAACTGAAACTGGG - Intergenic
1180971927 22:19820355-19820377 TCATGCTCCAAGCTGGAGCCAGG - Intronic
1182159944 22:28111635-28111657 TTACGAACAGAGCCGGAGCTGGG + Intronic
1183433438 22:37779843-37779865 TTAAGCACAAAGCTAGAGCTTGG - Intergenic
950640647 3:14346148-14346170 TTATGCCCAAATCTTGTGCTTGG + Intergenic
950653366 3:14421830-14421852 TTTTGCACACAGCTGCTGCTGGG + Intronic
951213081 3:19997130-19997152 TTATCAACAATGCTGGAGATGGG + Intronic
953096688 3:39783794-39783816 TTATACAGAAATCTGGAGCAGGG + Intergenic
956137844 3:66116643-66116665 TGTTACACAAAGCTGGATCTGGG - Intergenic
956836568 3:73100744-73100766 TGAGGCAGAAAGCTGGGGCTGGG - Intergenic
957147327 3:76441162-76441184 ATTTTCACAAAGCTGGTGCTTGG + Intronic
958041108 3:88227802-88227824 TTATGCATTAATCTGGAGCCTGG + Intergenic
960706322 3:120485406-120485428 TTATGGAAGAAGGTGGAGCTTGG + Intergenic
961036620 3:123646990-123647012 ATAAGCACAAGGCTGCAGCTGGG + Intronic
962337530 3:134549217-134549239 TTATGGACAAAGCTGTGGATTGG + Intronic
963470878 3:145740339-145740361 TGATCCACAAAGTTGGAGGTTGG + Intergenic
963988107 3:151620760-151620782 TGCTACACAAAACTGGAGCTAGG - Intergenic
965443740 3:168748802-168748824 TTGTGCACAATGCTGGAAATGGG + Intergenic
965954803 3:174356577-174356599 TTATGCATAAAACTGTATCTAGG - Intergenic
967790041 3:193538929-193538951 TTGTGCCCCAAGCTGGAGCACGG + Intronic
969202540 4:5617427-5617449 TTTTGCACACATCTGGTGCTTGG + Intronic
973365564 4:49205770-49205792 TTATGCAGAAAACTGAAACTGGG - Intergenic
973395030 4:49586684-49586706 TTATGCAGAAAACTGAAACTGGG + Intergenic
973959649 4:56097068-56097090 TGGTGCACAAAGTTGGAGGTTGG + Intergenic
977071440 4:92393240-92393262 TAATCCCCAAAGCTGGAGGTAGG - Intronic
978119889 4:105065714-105065736 CTCTGCACAGAGCTTGAGCTGGG - Intergenic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
978723697 4:111945615-111945637 TTATGTACAAAGTTGGAATTTGG - Intergenic
980271726 4:130592790-130592812 ATATGCACAAAGTTGAAGCCAGG - Intergenic
983859206 4:172683997-172684019 TAATTCGCAAAGCTGGAGCTGGG - Intronic
985128590 4:186719616-186719638 TTAGTGACAAAGCTGGAGCTAGG - Intronic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
987181793 5:15375371-15375393 TTAACCACACAGCTGGAGCAGGG - Intergenic
989963489 5:50441963-50441985 TTACCCACAAGGCTGTAGCTTGG + Intronic
990211403 5:53483759-53483781 TTAGGTACAAAGCTGGAGGAGGG - Intronic
991445122 5:66691554-66691576 TTTTGCACAATTCTGGAACTTGG + Intronic
993505270 5:88701416-88701438 TAATCCCCAAAGCTGGAGGTGGG + Intergenic
995225115 5:109692097-109692119 TTATGCAAACATCTGGACCTGGG + Intronic
996013229 5:118503811-118503833 TAATCCTCAAAGCTGGAGGTGGG + Intergenic
997226368 5:132212317-132212339 TTAAGCAGTAAGCTGGAGGTAGG + Intronic
999719842 5:154391555-154391577 TCATGAACCTAGCTGGAGCTAGG - Intronic
1000803974 5:165765610-165765632 TAATGCCCAATGCTGGAGGTGGG + Intergenic
1001824911 5:174736604-174736626 TAATGCAAATAGCTGGGGCTGGG - Intergenic
1002696095 5:181092188-181092210 TCAGGCACAGGGCTGGAGCTTGG + Intergenic
1004047542 6:12040983-12041005 TAATGCCCAATGCTGGAGGTGGG - Intronic
1004115885 6:12767656-12767678 TTATGCACAAAGATGGTGTAGGG + Intronic
1006879728 6:37328398-37328420 TTATGCACAAAGCCTTATCTTGG - Intronic
1007621238 6:43216060-43216082 GTATGCTCAAAGAGGGAGCTGGG + Intronic
1007898824 6:45391177-45391199 TGATTCCCAAAGTTGGAGCTGGG + Intronic
1008974694 6:57410994-57411016 TAATCCCCAAAGCTGGAGATGGG + Intronic
1009163581 6:60312500-60312522 TAATCCCCAAAGCTGGAGATGGG + Intergenic
1017920315 6:158866646-158866668 TTATGGTCAGAGTTGGAGCTTGG + Intergenic
1018413599 6:163581749-163581771 TTCTGCATAAAACTGGGGCTTGG - Intergenic
1018829507 6:167432530-167432552 CTAAGCACAAAGCTGCATCTGGG - Intergenic
1021103426 7:16609496-16609518 TTAGGAACAAAGGTGGAGATAGG - Intronic
1021150573 7:17146033-17146055 TTTTGCACAATGCAGGAGTTGGG + Intergenic
1022671174 7:32457749-32457771 TATTGGACATAGCTGGAGCTTGG + Intergenic
1024045520 7:45582886-45582908 TTCAGCACAAAGCCAGAGCTAGG - Intronic
1025017943 7:55455748-55455770 ATATGCAGAAAGCTGAAACTGGG + Intronic
1025724259 7:64043221-64043243 ATGTGCACAAAGCAGGAGTTGGG + Intronic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1028200862 7:87959312-87959334 ATATACATAAAGCTGTAGCTGGG + Intronic
1029331772 7:99862591-99862613 TTGTGCCCAAAGCTTGACCTTGG - Intronic
1031128294 7:117800836-117800858 TTAGCAACAAATCTGGAGCTAGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034973780 7:155436303-155436325 TTAGGCTCAAAGCTGTGGCTGGG + Intergenic
1035438491 7:158877551-158877573 TTATGTCCTAAGCAGGAGCTGGG + Intronic
1035864892 8:3071174-3071196 TAATGCCCAATGCTGGAGGTGGG - Intronic
1037411951 8:18607263-18607285 TTCTGCAGAAATGTGGAGCTGGG - Intronic
1038762539 8:30397764-30397786 TTATGCAGAAAACCAGAGCTAGG + Intronic
1038848717 8:31253949-31253971 TGAGGCACAGAGCTGGTGCTTGG + Intergenic
1040594539 8:48824851-48824873 TTTGGCCCAAAGCGGGAGCTTGG + Intergenic
1041219745 8:55637384-55637406 TTCTGCTCTAACCTGGAGCTGGG - Intergenic
1041521689 8:58763898-58763920 TAATGCACAAGGCTGGGGGTTGG + Intergenic
1041763974 8:61398025-61398047 TTTTGCACAAAAAAGGAGCTTGG + Intronic
1046216280 8:111152115-111152137 TAAAGCACAAAGCTTGAGCGTGG - Intergenic
1048226250 8:132589012-132589034 TAATGCCCAATGCTGGAGATGGG - Intronic
1048638770 8:136329164-136329186 TTATGCACAAAGATGGGATTTGG + Intergenic
1050328475 9:4521331-4521353 TTATGCTCAAAAATGGAGTTTGG + Intronic
1050793870 9:9511366-9511388 TTAAGCACATAGCTGATGCTAGG + Intronic
1052071349 9:24085366-24085388 ATATGCAGAAAACTGAAGCTAGG - Intergenic
1057104975 9:92406218-92406240 TTTTGCATACTGCTGGAGCTTGG + Intronic
1059457330 9:114407786-114407808 TTGTGCACAGACCTGTAGCTGGG + Intronic
1060106077 9:120874418-120874440 TCATGCCCAAAGCTGGTGGTGGG - Intronic
1185749681 X:2600816-2600838 TCATGCCCAATGCTGGAGGTGGG + Intergenic
1186556556 X:10566152-10566174 TTATCCCCCAAGCTGGAGTTAGG + Intronic
1186940879 X:14506254-14506276 TTATGCAAAACCCTGGAGCTTGG + Intergenic
1189015121 X:37089003-37089025 TTATGCAGAAAACCAGAGCTAGG + Intergenic
1191198333 X:57749052-57749074 ATATGCAGAAAGCTGAAACTGGG + Intergenic
1191216829 X:57941235-57941257 ATATGTACAAAGCTGAAACTGGG - Intergenic
1191606594 X:63069287-63069309 ATATGCAGAAAGCTGAAACTGGG + Intergenic
1191632389 X:63336162-63336184 ATATGCAGAAAACTGAAGCTGGG + Intergenic
1193268485 X:79501660-79501682 TTATGTGAAAAGCAGGAGCTGGG - Intergenic
1193460207 X:81782032-81782054 TTATGCTCAAAGTTGGAGGTGGG + Intergenic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1194784749 X:98068742-98068764 TTCAGAACAAAGCTGTAGCTTGG + Intergenic
1194895122 X:99431329-99431351 TTATCCACAATGCTGGAGGTGGG + Intergenic
1195160241 X:102163677-102163699 TTATCCCCAAAGTTGGAGTTGGG - Intergenic
1197501588 X:127248968-127248990 TTCTACAAAGAGCTGGAGCTAGG + Intergenic
1197728758 X:129793435-129793457 TTTAGCACTAAGCTGGAGCCAGG - Intronic
1199663889 X:150081433-150081455 TTATCCACTGAGCTGGTGCTGGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic
1200502705 Y:3971027-3971049 TTTTTCACAATGCTGGAGCCTGG + Intergenic