ID: 986830568

View in Genome Browser
Species Human (GRCh38)
Location 5:11572589-11572611
Sequence GAGGAGGGAAGAAGTTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1041
Summary {0: 1, 1: 0, 2: 11, 3: 97, 4: 932}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986830568_986830575 15 Left 986830568 5:11572589-11572611 CCACTTCAACTTCTTCCCTCCTC 0: 1
1: 0
2: 11
3: 97
4: 932
Right 986830575 5:11572627-11572649 CCACTAGCTAATATACCCACTGG 0: 1
1: 0
2: 1
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986830568 Original CRISPR GAGGAGGGAAGAAGTTGAAG TGG (reversed) Intronic
900315106 1:2052423-2052445 AAGGAGGGAGGAAGAGGAAGGGG - Intronic
900391616 1:2436290-2436312 GAGGAGGGAAGAAGGAGGAAAGG - Intronic
900531665 1:3156815-3156837 GAGGGGGGAAGCAGAGGAAGTGG + Intronic
901128063 1:6943199-6943221 GAGGAGGGGAGGAGGAGAAGAGG - Intronic
901145835 1:7064138-7064160 GAGGAGGGAAGAAGAGAAGGAGG - Intronic
901664811 1:10820096-10820118 GAGGAGGAAACAAGGTGGAGGGG + Intergenic
902684673 1:18068210-18068232 GAGGAGGAAGGAAGTTGAGAAGG + Intergenic
902684677 1:18068232-18068254 GAGGAGGAAGGAAGTTGAGAAGG + Intergenic
902844450 1:19098913-19098935 GAGAAGGGAAGAAATGGCAGGGG + Intronic
903455624 1:23484615-23484637 GAGGAGGGAGGAAGAGGGAGGGG - Intergenic
904715250 1:32463153-32463175 GAAGAGGGAAGAAGAAGAAGAGG - Intergenic
904866155 1:33580572-33580594 AAAGAGGGAAGAGGTTCAAGAGG + Intronic
905319061 1:37102890-37102912 GAGGAGGGAGGAGGAGGAAGAGG + Intergenic
905345315 1:37307260-37307282 GAGGAGGAAAGAAGGAGGAGAGG + Intergenic
905569181 1:38990959-38990981 GGGGAGGGGAGAGCTTGAAGGGG - Intergenic
906474395 1:46158417-46158439 GAGGGTGGATGAAGATGAAGTGG - Intronic
906509160 1:46401072-46401094 GGGGAGGGAAGAGGGGGAAGTGG + Intronic
906558915 1:46739558-46739580 AAGGAGGGAAGAAGGGAAAGAGG - Intergenic
906590614 1:47021615-47021637 GAGGCTGGAAGGTGTTGAAGAGG - Intergenic
906644698 1:47465983-47466005 GTGGATGGGAGAAGTAGAAGAGG - Intergenic
907226262 1:52949914-52949936 GAGGAGGAAAGTCTTTGAAGAGG + Intronic
907286147 1:53381069-53381091 GGGAAGGGAAGAAGTAGAAGAGG - Intergenic
908733667 1:67253233-67253255 CAGGAGGGAAAAAACTGAAGGGG - Intronic
909253650 1:73390504-73390526 GAAGAAGGAAGAAGAGGAAGAGG - Intergenic
909629463 1:77756471-77756493 GAGGAGAGAAGTAGTTGAGATGG - Intronic
909837507 1:80275747-80275769 GTGGATGGATGAAGTGGAAGTGG + Intergenic
910332971 1:86097448-86097470 GAGGAGGGAGGAAGAGGAGGGGG - Intronic
910338252 1:86156812-86156834 GGGTAGGGAAGGAGATGAAGTGG + Intronic
911091655 1:94022185-94022207 GAGGAAGGATGAAGTTGGAGAGG - Intronic
911102290 1:94104420-94104442 GGGGAGGGGAGAATTTGGAGAGG - Intronic
912067404 1:105761243-105761265 GTGGAGGAAAGAAGGTCAAGTGG + Intergenic
912165009 1:107032709-107032731 GAGGAGGAGAGTAGTTGCAGAGG - Intergenic
912419476 1:109533260-109533282 GAGGAGGGGAAAAGGTGGAGTGG - Intergenic
912669413 1:111610508-111610530 GTGGAGGGAAGTAGTGGAATAGG - Intronic
912710302 1:111945038-111945060 GAGGAAGGAAGGAGGTCAAGTGG + Intronic
913255488 1:116949600-116949622 GAGGAGGGGTTAAGCTGAAGAGG - Intronic
913380191 1:118202206-118202228 AATCATGGAAGAAGTTGAAGTGG + Intergenic
914245769 1:145885034-145885056 GAGTAGGGCAGAGGTTGGAGGGG + Intronic
914492106 1:148158777-148158799 GAGGAGGAAATAACTTGAATAGG - Intergenic
914857277 1:151361995-151362017 GAGGAAGGAAGGAGAAGAAGAGG + Intergenic
915308188 1:154993143-154993165 GAGGATGGGAGAAGCAGAAGTGG + Intergenic
915314270 1:155019110-155019132 GATGAGTCAAGAGGTTGAAGGGG - Intronic
916474681 1:165157931-165157953 GGGGAAGGATGAAGGTGAAGTGG - Intergenic
916740671 1:167644655-167644677 GTGGGGGGAGGAAGTGGAAGGGG - Intronic
916818663 1:168377164-168377186 CACAAGGAAAGAAGTTGAAGGGG - Intergenic
916847999 1:168672933-168672955 GAGGAGGGAAAAAGTGGAGAAGG - Intergenic
916879173 1:169002245-169002267 AAGAAGGGATGAAGTTGAAAAGG + Intergenic
916881627 1:169024565-169024587 GAGGAGGAAGGAAGGAGAAGAGG + Intergenic
917005795 1:170415992-170416014 GAGGAGGCAAGAAGGGGATGGGG - Intergenic
917122454 1:171656236-171656258 GATGAGGGAAGAAAGTGATGAGG + Intergenic
917226659 1:172790802-172790824 GAGGAGGGAAGGAGGTTCAGAGG + Intergenic
917245021 1:172991368-172991390 GCAAAGGGAAGAAGTAGAAGTGG + Intergenic
917409343 1:174742086-174742108 GAGGAGGAAAGAAGAAGAAGAGG + Intronic
917409366 1:174742166-174742188 GAGGAGGAAAGAAGAAGAAGAGG + Intronic
917948384 1:180001562-180001584 GAGTAGGGATAAATTTGAAGTGG + Intronic
918627983 1:186680512-186680534 GAGGAGGGAAAAATTTGTGGGGG - Intergenic
919709927 1:200716240-200716262 GAGGAGAGAAGAACTTGATCTGG + Intergenic
919913534 1:202126560-202126582 GAAGAGGGAAGAATTTGGACAGG + Intronic
919920236 1:202162992-202163014 GTGGAGGGAGGAAGCTGAGGAGG - Intergenic
920036992 1:203072541-203072563 GAGGAGGGAGGAAGAGGAGGCGG - Intronic
920067624 1:203280240-203280262 GAGCAGGGGAGAAAGTGAAGAGG - Intergenic
920136674 1:203775057-203775079 AAGGAAGGAAGAAGTTGGAGTGG + Exonic
920261915 1:204694031-204694053 GTGAAGGGAAGATGGTGAAGTGG + Intergenic
920380254 1:205530862-205530884 GAGGAGGGAAGAGCTGGACGAGG - Intronic
920834203 1:209492986-209493008 GAGTAGGTAAGAACTTGTAGAGG - Intergenic
920988481 1:210913067-210913089 GAGGAGGGGAGAAAGTGATGTGG + Intronic
921342132 1:214144874-214144896 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
921396855 1:214677799-214677821 GAGGAGGGAGGAGGGAGAAGGGG - Intergenic
921581944 1:216905450-216905472 GAGGAGGGTTGAACTTTAAGGGG - Intronic
921674731 1:217965221-217965243 GAGGGAGGCAGAAGTGGAAGAGG - Intergenic
921853477 1:219955175-219955197 GAGTAGGGGAAAGGTTGAAGGGG - Intronic
921974169 1:221182866-221182888 GAGGAGAAAAAAAGTTGGAGGGG + Intergenic
922082928 1:222315237-222315259 AAGGAGAGAATAAGATGAAGAGG + Intergenic
922209988 1:223479222-223479244 GAGGAGGTAAGAGGGTGAGGAGG + Intergenic
922254158 1:223877707-223877729 AAGGATGGAAGAAGTAGATGAGG + Intergenic
922608170 1:226904122-226904144 GAGGAGGGAAGAAGAGTAGGAGG - Intronic
922623576 1:227013421-227013443 GAAGAGGGAAGAAAATGTAGAGG + Intronic
922825845 1:228517913-228517935 GAGGAGGGAAGAAGGGGAAGGGG - Intergenic
922825857 1:228517945-228517967 GAGGAGGAAAGAAGGGGAAGGGG - Intergenic
922925005 1:229341426-229341448 GGGCAGGAAAGAAGGTGAAGGGG + Intronic
922976668 1:229790465-229790487 GAGGAGGGAAGTCTTTGAAGAGG - Intergenic
922987708 1:229878895-229878917 GAGGCTGGAAGAAGATGAAGTGG + Intergenic
923963762 1:239112784-239112806 GAGGTGGGCAAAAGTAGAAGTGG + Intergenic
924045183 1:240021906-240021928 GAGGAGGGCAGTATTTGAAGTGG - Intronic
924503112 1:244654609-244654631 CAGGACAGAAAAAGTTGAAGAGG + Intronic
924717457 1:246590485-246590507 GAGGAGGGCAGCAGGAGAAGTGG + Intronic
1063225746 10:4013339-4013361 GAAGAGGGAGGACGGTGAAGGGG - Intergenic
1063258232 10:4352998-4353020 GAGGAGGTGAGAAGGTGAGGAGG - Intergenic
1063366404 10:5493528-5493550 GAGCAGGGAGAAAGTTCAAGAGG - Intergenic
1063577581 10:7275486-7275508 GAAGAGGGAAGGAGAGGAAGAGG + Intronic
1064584794 10:16829231-16829253 GAGGATGGAAGAGGTGGAGGTGG - Intronic
1064627240 10:17273840-17273862 GAGGAGGGAAGAAGGAGGAAGGG - Intergenic
1064975780 10:21113124-21113146 GAGGAGGGAAGAGGAGGAGGAGG + Intronic
1065025192 10:21534395-21534417 GGGGAGGGAAGACGCTGAGGAGG + Exonic
1065043100 10:21717566-21717588 GAGGAAGAAAGAAGAGGAAGAGG - Intronic
1065043102 10:21717585-21717607 GAGGAAGAAAGAAGAGGAAGAGG - Intronic
1065171260 10:23032288-23032310 GAGCAAGGAAGAAGAGGAAGAGG - Intronic
1065283575 10:24165284-24165306 GGGAATGGAAGAAGTTGAATAGG + Intronic
1065484810 10:26227511-26227533 AAGGAGGGAAGAAGAGAAAGGGG - Intronic
1065725187 10:28662124-28662146 GAGAAGGGAAGGAGAGGAAGGGG - Intergenic
1065762426 10:28994595-28994617 GAGGAAGGAGGAAGATTAAGGGG - Intergenic
1066007299 10:31157463-31157485 TAGGAAGGAAGAACTTGGAGAGG - Intergenic
1066047589 10:31606809-31606831 GGGAAGGGCAGAAGTTGAAGAGG - Intergenic
1066236819 10:33493023-33493045 GAGAAGGGAAGCAGTGGAAAAGG - Intergenic
1066492460 10:35906850-35906872 GAGGTGGGAGGAATTTTAAGAGG + Intergenic
1067105588 10:43363934-43363956 GAAGAGGGCAGAAGTTGTTGCGG - Intergenic
1067237921 10:44467265-44467287 GAGGAGGGAATAGGATGTAGAGG + Intergenic
1067438132 10:46293005-46293027 GAGGAGGGAATGGGGTGAAGAGG + Intronic
1067574937 10:47403142-47403164 GAGGAGGGAATGGGGTGAAGAGG + Intergenic
1067687697 10:48477125-48477147 GAGGAGGGAAGAGGTTAAGATGG - Intronic
1067831663 10:49614247-49614269 GAGGAGGGAGGAGGTACAAGAGG + Exonic
1068001424 10:51338481-51338503 TAGGAGGGAGGAAGTGGAAATGG + Intronic
1068553276 10:58429583-58429605 GAAGAGTGAAGGAGTGGAAGGGG - Intergenic
1069359279 10:67623592-67623614 GAGTAGAGAAGAAGCTGAAAGGG + Intronic
1069424965 10:68280413-68280435 GAGGTGGGCAGAGGTGGAAGAGG + Intergenic
1069452806 10:68530704-68530726 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
1069548376 10:69344962-69344984 GAGCAGGGAAGAAATCGCAGGGG - Intronic
1069872296 10:71540569-71540591 GAGCAGGGAAGAAGTGAAATGGG - Intronic
1069910782 10:71757840-71757862 GGGGTGGGAAGAAGTTCAAAGGG + Intronic
1070342928 10:75514266-75514288 GAGGAAGGAAGAAGGAGGAGGGG - Intronic
1070834228 10:79437894-79437916 CAGGAGGGTAGAAGCTGCAGAGG + Intronic
1071802984 10:89085439-89085461 GAGGAGGTAGAATGTTGAAGGGG + Intergenic
1071824031 10:89306619-89306641 GATGCGTGAAGAAGGTGAAGAGG + Exonic
1071871528 10:89800426-89800448 AAGGAGGGAAGGAAGTGAAGGGG + Intergenic
1072071984 10:91927003-91927025 GAAGAGAGAAGAAGGTGAAGGGG - Intronic
1072332182 10:94364554-94364576 GAGCAAGGAAGAAGTTGGAAGGG - Intergenic
1072455084 10:95568425-95568447 GAGGAGGGCAGAAGTGAAGGTGG + Intergenic
1072668166 10:97409550-97409572 GAAGAATGAAGAATTTGAAGTGG - Intronic
1072957660 10:99901650-99901672 GAGGAGGAAAGAAGGGCAAGAGG - Intronic
1073059019 10:100722392-100722414 GTGGGGGGATGAAGTCGAAGGGG + Intergenic
1073170594 10:101504595-101504617 GAAGAGGGTAGAAGAGGAAGAGG - Intronic
1073400263 10:103251263-103251285 CATGATGGAAGAAGTTGAGGTGG - Intergenic
1073592193 10:104767806-104767828 GAGGGGGGAAGAAGAGGGAGGGG - Intronic
1073688544 10:105782639-105782661 GAGCAGTGAAGAGGTTGAAAGGG + Intergenic
1073939355 10:108677243-108677265 GATGAGAAAAGAAGTTGAATGGG - Intergenic
1074412757 10:113242492-113242514 GAGGAGAGGAGAAGTGGAAAGGG + Intergenic
1074781281 10:116804126-116804148 GAGGAGGGAGGAAGGACAAGAGG - Intergenic
1074921527 10:118019352-118019374 CAGGAGGGAAGAGGAGGAAGAGG + Intronic
1074940788 10:118234443-118234465 GATGAAGGGAGAAGTAGAAGTGG + Intergenic
1075653441 10:124145388-124145410 CAGTGGGGAAGAAGTTCAAGGGG - Intergenic
1075679750 10:124323583-124323605 GAGGAGGGAAGGAGAGAAAGGGG + Intergenic
1075703607 10:124484997-124485019 GAGGAAGGAAGAAGGTGCAGTGG - Intronic
1075805971 10:125189118-125189140 GAGGAGGGAAGAGATGGCAGAGG - Intergenic
1076153230 10:128180748-128180770 GAGGAGGGAAGCAATTGAGCTGG + Intergenic
1076239958 10:128897325-128897347 GAGGGGGGAGGAAGAGGAAGAGG + Intergenic
1076900233 10:133334447-133334469 GAGGGGGGAAGACTCTGAAGGGG + Intronic
1077191209 11:1256561-1256583 GAGCAGGGAAGGAGATGAATGGG - Intronic
1077299318 11:1839850-1839872 GAGGAGGTAAGTAGTTGCTGGGG + Exonic
1077561206 11:3262710-3262732 GAGAAGGGAAGGAGGTGGAGAGG - Intergenic
1077567100 11:3308539-3308561 GAGAAGGGAAGGAGGTGGAGAGG - Intergenic
1077704167 11:4468191-4468213 GAGGAGGGCAGAGGTTGGTGAGG + Intergenic
1077740995 11:4845237-4845259 ACGGATGAAAGAAGTTGAAGAGG + Intronic
1078099386 11:8320791-8320813 GAGGAGAGGAGAAGTTGGTGGGG + Intergenic
1078507170 11:11960910-11960932 GAGGGAGGATGAGGTTGAAGAGG - Intergenic
1078637694 11:13066869-13066891 GAGTAGGGTAGCAGTTGAGGTGG - Intergenic
1078795443 11:14587504-14587526 GAGCAGTGAAGAAGTCGAAAAGG - Intronic
1078877795 11:15415470-15415492 GAGAAGGGAGGAGGGTGAAGAGG + Intergenic
1078913222 11:15752815-15752837 TTGGAGGGAAGAAGGGGAAGGGG - Intergenic
1079110529 11:17602712-17602734 GAGGAGGGAAGAAGGGAGAGAGG - Intronic
1079165524 11:18038074-18038096 GAGTGGAAAAGAAGTTGAAGAGG + Intronic
1079410285 11:20181111-20181133 GAGGAGAGAAGAAGAGGAAGAGG - Intergenic
1079425853 11:20341891-20341913 GAGGAGGTAGGAGCTTGAAGGGG - Intergenic
1079583340 11:22093821-22093843 GAGGAGAAAAAAAGTTAAAGGGG + Intergenic
1079845975 11:25468172-25468194 GAGGAGGGCAGCAGGAGAAGTGG + Intergenic
1080048716 11:27836597-27836619 GAGGAGGAAAGAAATTGGGGCGG + Intergenic
1080087386 11:28300942-28300964 TAGGAGAGATGAAGATGAAGAGG - Intronic
1080191349 11:29552910-29552932 GAGGAGGGGAGAAAATGGAGAGG + Intergenic
1080223714 11:29936051-29936073 TAGGAGGTAAGAAGTTTAAATGG + Intergenic
1081323211 11:41716246-41716268 GAGGAGGCAAGAAGTTGCTGTGG - Intergenic
1081712128 11:45224214-45224236 TAGGAGAGAAGAGGTTGCAGAGG + Exonic
1081734809 11:45395236-45395258 GAGGAGGAAGGAAGAGGAAGAGG - Intergenic
1082013508 11:47467206-47467228 GTGGAGGGAAGAGGTTACAGGGG - Intronic
1082779623 11:57276738-57276760 GGGGAAGGGAGAAGTGGAAGAGG + Intergenic
1083538898 11:63497708-63497730 AATGATGAAAGAAGTTGAAGAGG - Intergenic
1083725788 11:64627337-64627359 GAGGAGGTGAGAAGGGGAAGGGG - Intronic
1083885642 11:65572364-65572386 GAGGGGGGAAAAGGCTGAAGGGG - Intronic
1084156404 11:67315507-67315529 GAGGAGGGCAGAATGTCAAGAGG - Intergenic
1084214428 11:67639841-67639863 GGGAAGGGAGGAACTTGAAGAGG - Intergenic
1084989780 11:72911646-72911668 AAGGAAGGAATAAATTGAAGAGG - Intronic
1085353716 11:75816794-75816816 GAGGAAGGGAGAGGTTGTAGGGG + Intronic
1085780375 11:79402687-79402709 GAAGAGGGAAGTAGGTGAAATGG - Intronic
1085823089 11:79814066-79814088 GAAAAGGGAAGAAGTTGAATTGG - Intergenic
1086101254 11:83102254-83102276 GTGGAGTGCAGAAGTTGTAGAGG - Intergenic
1086934791 11:92733070-92733092 GAGGAGGGAAGATGTGGAGTAGG + Intronic
1087018783 11:93581169-93581191 AAAGAGGGGAGAGGTTGAAGAGG - Intergenic
1087310550 11:96537013-96537035 TAGGAGGGAAGAAGTTAAGTAGG + Intergenic
1087340504 11:96899724-96899746 GAGGAGGGAAAATGTTTAATAGG - Intergenic
1087669527 11:101089026-101089048 GAGGAAGGAAGAAGAAGAAAGGG + Intronic
1087747649 11:101967855-101967877 GGGGAGAGAAGAAGGTGAATAGG + Intronic
1088066088 11:105721231-105721253 GAGGTGGAAAGATTTTGAAGAGG + Intronic
1088469185 11:110175976-110175998 GAGGTGGGAAGCAGTGGGAGAGG + Intronic
1088795283 11:113262170-113262192 AAGCAGGGTAGAAGGTGAAGCGG + Intronic
1088860053 11:113790781-113790803 GAGGTTGCAAGAAGGTGAAGGGG - Intergenic
1089200198 11:116720195-116720217 AAGAAGGGAAGACGTTGCAGAGG - Intergenic
1089457629 11:118634679-118634701 GAGGAGGGAAAGAGGTGAAGAGG - Intronic
1089749026 11:120637121-120637143 GAGGAGGGAAGGAGGTGAGAGGG + Intronic
1089749390 11:120639683-120639705 GAGGAAGGTAGAAGTGGCAGAGG - Intronic
1089815602 11:121171580-121171602 GCTGATGGAAGAAATTGAAGAGG - Intronic
1090597836 11:128338218-128338240 GCGGTGGGAAGAAGGTGCAGAGG + Intergenic
1090787303 11:130061139-130061161 AAGGAAGGAAGAAGGGGAAGGGG + Intergenic
1091070461 11:132558284-132558306 GAGGAGGGGAGAAGAGGAAGAGG - Intronic
1091070511 11:132558401-132558423 GAGGAGGGGAGAAGGGGAAGAGG - Intronic
1091328859 11:134714527-134714549 GAGGAGAGAGGAAGTGGGAGAGG + Intergenic
1091831185 12:3552269-3552291 GAAGAGGGAAGAAATGGAAGAGG + Intronic
1092040291 12:5378319-5378341 GGGGAGGGAGGAGGCTGAAGGGG - Intergenic
1092217570 12:6693947-6693969 AAGGAGGGAAGAACCTGAGGAGG + Exonic
1092495960 12:8995448-8995470 GAAGAAGGCAGAAGTAGAAGAGG - Intronic
1092618340 12:10235863-10235885 TAGGAGGGAAGAATTAGAGGTGG - Intergenic
1092964617 12:13629618-13629640 GAGGAGGGAAGGAGGGAAAGAGG - Intronic
1093760797 12:22907177-22907199 GAGGAGGGAAGAATGGAAAGAGG + Intergenic
1094427363 12:30328800-30328822 GAAGGGTGAAGAAGATGAAGAGG - Intergenic
1094617087 12:32045801-32045823 GAGGAGTAAACAAGCTGAAGTGG + Intergenic
1094651659 12:32384687-32384709 GAAGAAGGAAGAAGAGGAAGAGG - Intergenic
1095440563 12:42235571-42235593 GAGGAAGGAAGAAGCTGAGAGGG + Intronic
1095508455 12:42923796-42923818 GAGGAGGGAAGCAATTGGAAAGG + Intergenic
1095700923 12:45190079-45190101 AAGGAGGGAAGAAGGGAAAGAGG - Intergenic
1096149140 12:49297755-49297777 GAGGAGGGCAGAAGTGGACAAGG - Intronic
1096282252 12:50266423-50266445 GAGGTGGGAAGATGTTCAAGAGG - Intronic
1096595000 12:52689448-52689470 GAGGAGGGAAGAAGAAGAAGAGG + Intergenic
1096820526 12:54230311-54230333 GAGAAGTGAGGAAGATGAAGGGG - Intergenic
1096886144 12:54721296-54721318 GAGGAGAGAAGAAGAAGAAGAGG - Intergenic
1097008113 12:55933302-55933324 GAGAAAGGAAGAAGTTGACTTGG - Intronic
1097020777 12:56019448-56019470 AAGGAGGGAAGGAGTTGGAATGG + Intronic
1097384600 12:58934406-58934428 GAGAAGGGAAAAACTTAAAGAGG + Intergenic
1097789623 12:63801083-63801105 GAGGAGGAAGGAAGATGAAAGGG - Intronic
1097856916 12:64473128-64473150 TAGGAGGAAACAAGTTTAAGTGG + Intronic
1098009935 12:66040257-66040279 GAGGAGGCTAGAATTTGCAGGGG - Intergenic
1098301562 12:69059737-69059759 GATGAGAGAAGAAGATAAAGAGG + Intergenic
1098495873 12:71135250-71135272 GAGGAGGTAAGAAGAGGAGGAGG + Intronic
1098652119 12:72985788-72985810 GAGGAGGGTAGAGTTTGAGGTGG - Intergenic
1098919172 12:76287150-76287172 GAGGAGGAAAGAAGAAAAAGAGG + Intergenic
1099138145 12:78934659-78934681 GAAAAAGAAAGAAGTTGAAGTGG + Intronic
1099218015 12:79877147-79877169 GTGGAGGGAAGAAGTGTGAGGGG + Intronic
1099233264 12:80052204-80052226 CAGGAGGGAAGCAGTGGAGGTGG - Intergenic
1099957047 12:89361061-89361083 GAGGAGAGAAGTGGTAGAAGAGG - Intergenic
1101064204 12:101002472-101002494 GAGAAGGGAAGAAGCTAAAAAGG - Intronic
1101129258 12:101671967-101671989 GAGAAGGGAAGAAACTGAAAGGG + Intronic
1101311084 12:103579983-103580005 GGGGAGGGAAGATGCTGAAAGGG + Intergenic
1101645158 12:106624667-106624689 GAGGGGGGAAGAAGAAGAAAAGG + Intronic
1101673282 12:106896578-106896600 GAGGAGGGGAGGAGAGGAAGGGG + Intergenic
1101843078 12:108341867-108341889 GAGGAGGGAAAAAGGAGAGGAGG + Intergenic
1101843199 12:108342269-108342291 GAGGAGGGAAGAGGAAGAAAGGG + Intergenic
1102046141 12:109831591-109831613 GAGGAGGGAGTAAGTGGCAGAGG + Intronic
1102238542 12:111309586-111309608 GAGGAGGGAAGGGGTTGGTGGGG - Intronic
1102394262 12:112574243-112574265 GGGGAGGGAGGAAGAGGAAGAGG + Intronic
1102746230 12:115251347-115251369 GAGGAAGGAAGAAGATGAGGAGG + Intergenic
1102746259 12:115251535-115251557 GAGGAAGGAAGAAGATGAGGAGG + Intergenic
1102974955 12:117200112-117200134 GAGGAGGAAAGAGGAAGAAGTGG - Intergenic
1103147823 12:118610801-118610823 GAAAAGGGAAGAGGTTGCAGAGG - Intergenic
1103323971 12:120108273-120108295 GAGGAGGGAAGAAGATGGAGTGG - Intronic
1103425504 12:120830378-120830400 GAGGGGGGAAGAAGGGGGAGGGG + Intronic
1103425550 12:120830463-120830485 GAGGGGGGAAGAAGGGGGAGGGG + Intronic
1103425566 12:120830492-120830514 GAGGGGGGAAGAAGGGGAGGGGG + Intronic
1104092685 12:125529019-125529041 GAGGAGGGAGGAAGAAGGAGGGG - Intronic
1104110138 12:125697047-125697069 GAGGAGGGAAGAATTGCAGGAGG + Intergenic
1104657196 12:130582111-130582133 GAGGAGGGAGGGAGGTGGAGGGG - Intronic
1105023602 12:132834303-132834325 GAGCAGGGGAGAGGGTGAAGCGG + Intronic
1105299453 13:19119001-19119023 GAGGAGGAAAGAGGGTGATGGGG + Intergenic
1106090781 13:26591395-26591417 GAGGATGCAAGCAGTTGAGGTGG + Intronic
1106542267 13:30700541-30700563 GTGGAGGGAGGAAGTTGTGGAGG - Intergenic
1107134973 13:36933789-36933811 GAGTAGGAAAGAAGTGGATGTGG - Intergenic
1107355987 13:39567593-39567615 GAGGAAGGAAAAGGTAGAAGAGG - Intronic
1107459791 13:40590912-40590934 GAGTAGGTATGAAGTAGAAGAGG - Intronic
1107676478 13:42802999-42803021 AAGGAGGAAAGAAATTTAAGGGG - Intergenic
1107690322 13:42947107-42947129 GAGGAGGGAGGAGGGGGAAGTGG - Intronic
1107758492 13:43651261-43651283 GGGGAGGGAAGGAGGAGAAGAGG + Intronic
1107828615 13:44353610-44353632 GGGGAAGGAAGAAGTGGAATGGG + Intergenic
1108128313 13:47269197-47269219 GAGGATTGAAGAAGTCCAAGAGG - Intergenic
1108243690 13:48493574-48493596 GGGGAGGGAAGTAGCTGATGAGG - Intronic
1108356550 13:49633643-49633665 GAGAGAGGAAGAATTTGAAGAGG + Exonic
1108822344 13:54368678-54368700 AAGGAGGGAAGAAGGGAAAGAGG + Intergenic
1109180927 13:59213357-59213379 GAGCAGGGGGAAAGTTGAAGAGG - Intergenic
1109190159 13:59313957-59313979 GAGAAGGGAAGCAGGGGAAGAGG - Intergenic
1109980106 13:69896222-69896244 AAGGAGAGAAGAGGCTGAAGGGG - Intronic
1110234761 13:73205121-73205143 GAGGAAGGAAGCAGGTGAGGAGG + Intergenic
1110306016 13:73987682-73987704 GAGGAGAGAAGAAGTGGGAGAGG + Intronic
1110306038 13:73987774-73987796 GGGGAGAGAAGAAGTGGGAGAGG + Intronic
1111004185 13:82227676-82227698 TATGGGGGAAAAAGTTGAAGTGG - Intergenic
1111705857 13:91748745-91748767 GATTAGGGAAGGAGTTGGAGAGG + Intronic
1111773945 13:92635441-92635463 GTGGAAGGTAGAAGTTGAAAGGG + Intronic
1112311084 13:98318036-98318058 AAGGAAGGAAGGAGATGAAGAGG - Intronic
1113163925 13:107416371-107416393 AAGGAGGGAAGAGGTAGAAGAGG - Intronic
1113202581 13:107883412-107883434 GAGGATGGAACATGTTGAAGAGG + Intergenic
1113352689 13:109544805-109544827 AATGAGGGAAGAAGTAGAATGGG + Intergenic
1113498852 13:110757323-110757345 GATCAGGCAAGAAGATGAAGGGG - Intergenic
1113908995 13:113832979-113833001 GAGCAGGGAAGGAGATGACGGGG - Intronic
1114557857 14:23571959-23571981 GAGCAGGGACTAACTTGAAGTGG - Intronic
1114657243 14:24323460-24323482 GAGGAGATGAGGAGTTGAAGAGG + Intronic
1114979220 14:28141658-28141680 GAGGAGGAAAGGAGTTGAAATGG + Intergenic
1115076426 14:29397820-29397842 GAGGTGGGAGGAAGTGGATGTGG - Intergenic
1115467847 14:33735702-33735724 GAGAAAGGGAGAATTTGAAGGGG - Intronic
1115498301 14:34027479-34027501 GAGGGGGGAAGAAGGGGAGGGGG + Intronic
1115659120 14:35474541-35474563 GAGGAAGGAAGAGGAAGAAGAGG - Intergenic
1115659123 14:35474560-35474582 GAGGAGGTAAGAGGAAGAAGAGG - Intergenic
1115768849 14:36649352-36649374 GTGGAGAAAAGAAGTTGAAGAGG + Intergenic
1116289986 14:43022383-43022405 GAGGAGGGAGGGAGGAGAAGAGG - Intergenic
1116326188 14:43535718-43535740 GATGAGGAAAGAAGTTTAATCGG - Intergenic
1117052489 14:51875293-51875315 CAGGATGGAAGAAGTTGGAAGGG + Intronic
1117240350 14:53825989-53826011 GGAGAGGGATGAAATTGAAGAGG + Intergenic
1117556034 14:56884905-56884927 GGGGAGGGGAGAATTTGGAGAGG - Intergenic
1118042342 14:61930751-61930773 GAAGAGGGAAGCAGACGAAGAGG + Intergenic
1118328037 14:64794756-64794778 GAGGATGGAAGAAGCTCCAGAGG + Intronic
1119213722 14:72852057-72852079 GGGAAGGCAGGAAGTTGAAGAGG + Intronic
1119368277 14:74114360-74114382 GAGGAGGCAGGAAGTTACAGTGG + Intronic
1119615931 14:76099229-76099251 CAGCAGGGAAGGAGGTGAAGGGG - Intergenic
1119618622 14:76114929-76114951 AAGGAGGGAAGAAGAGGAAGAGG + Intergenic
1119940275 14:78633459-78633481 GAGGATGGGATATGTTGAAGGGG - Intronic
1119960439 14:78849691-78849713 GTGGAGGGAAGGAGTGGAATTGG + Intronic
1121229084 14:92343114-92343136 AAACAGGGAAGAAGTGGAAGGGG - Intronic
1121334133 14:93066742-93066764 GAGCAGGGAAGGGGCTGAAGAGG + Intronic
1121954564 14:98202302-98202324 GAGTGAGGAAGAAATTGAAGTGG - Intergenic
1121984898 14:98495761-98495783 GAAGAAGGAAGAAGAGGAAGAGG + Intergenic
1122314129 14:100815723-100815745 GATGAGGGGAGAAGGTGAACGGG - Intergenic
1122359451 14:101150884-101150906 GAGGAGGGAAGGAAGGGAAGGGG - Intergenic
1122624649 14:103078184-103078206 AAGGAGGGAAGCAGAGGAAGGGG + Intergenic
1202900750 14_GL000194v1_random:35777-35799 GAGGAGGGTGGCACTTGAAGGGG - Intergenic
1123479404 15:20617099-20617121 GAGCAGGGAGGAAGGAGAAGTGG + Intergenic
1123994148 15:25706586-25706608 GAGCAGGGAAGATGGAGAAGGGG + Intronic
1124361394 15:29039014-29039036 GATCAAGGAAGAAGATGAAGCGG + Intronic
1125049732 15:35283013-35283035 GAAGAAGGAAGAAGAGGAAGAGG - Intronic
1125049762 15:35283253-35283275 GAGGAAGAAAGAAGAAGAAGAGG - Intronic
1125172695 15:36784284-36784306 GAGTAGGGAGGAAGTGGAGGAGG + Intronic
1125397108 15:39261033-39261055 GAGGAGAGAAGAAGGGGGAGGGG + Intergenic
1125532755 15:40424269-40424291 AAGGAGGGAAGCAGCAGAAGGGG - Intronic
1125788405 15:42343332-42343354 GAGGAGGGAGAAAGATGAATTGG + Intronic
1126462173 15:48926031-48926053 GAGAAGGGAAGATGATGAATTGG + Intronic
1126704843 15:51397419-51397441 AAGGAGGCAAGAGGTAGAAGGGG - Intronic
1127798637 15:62458869-62458891 GAGGAGGGCAGAGGTAGGAGAGG - Intronic
1128185336 15:65639737-65639759 CAGGAGGGAAGGAGTGGATGGGG - Intronic
1128305247 15:66594035-66594057 GAGGATGGAAGAAGGGGAAAAGG + Intronic
1128565018 15:68695346-68695368 GAGGAGGGAAGAAGGGCAAAGGG - Intronic
1128867410 15:71125084-71125106 GAAGAGGAGAGAAGGTGAAGAGG + Intronic
1128900584 15:71417898-71417920 ATGGATGAAAGAAGTTGAAGAGG - Intronic
1129178607 15:73857439-73857461 GAGGTGGGAGGAAGCTGGAGAGG - Intergenic
1129893257 15:79086004-79086026 GAGTTGGAATGAAGTTGAAGAGG - Intronic
1130345805 15:83043587-83043609 AAGGAGGGTAGCAGTGGAAGTGG + Intronic
1130643287 15:85699524-85699546 AAGGAGAAAAGGAGTTGAAGAGG + Intronic
1131139856 15:89968214-89968236 GAAGAGGGAAGAAGAAGAGGAGG + Intergenic
1131284693 15:91047711-91047733 GAGGGAGGAGGAAGGTGAAGGGG - Intergenic
1131430148 15:92380769-92380791 GAGGAGGGAAGAAGAAGAAGAGG + Intergenic
1131434518 15:92412355-92412377 GAGGAGGGATGAAGGTTCAGAGG + Intronic
1131769631 15:95721914-95721936 GAGGAGGAATGAAGTTATAGTGG - Intergenic
1132396316 15:101477734-101477756 GAGGAGAGAAGAGGCTGGAGGGG - Intronic
1132770329 16:1558660-1558682 GAAGAGGCAAGCAGTTGGAGGGG - Intronic
1133460681 16:5983949-5983971 GAAGAAGGAAGAAGAAGAAGAGG - Intergenic
1133469247 16:6058301-6058323 GAGGAGGGAGGAAGAAGAGGAGG - Intronic
1133469251 16:6058317-6058339 GAGGAGGGAGGAAGGAGAGGAGG - Intronic
1133520218 16:6549352-6549374 GAGGAGGGAAGGAGGAGGAGGGG + Intronic
1133611821 16:7440768-7440790 AGGAAGGGATGAAGTTGAAGAGG - Intronic
1133866033 16:9644168-9644190 TTGGTGGGAAGAAGCTGAAGGGG + Intergenic
1134087463 16:11367834-11367856 GAGGAAGGAAGAACTGGGAGGGG + Intronic
1134122730 16:11596507-11596529 GAGGAGGAAAGGAGAAGAAGGGG + Intronic
1134321977 16:13172064-13172086 GAGGAGGGAAGGAGGGAAAGGGG - Intronic
1134449358 16:14354110-14354132 GAGGAGGGAAGGAGGAAAAGAGG + Intergenic
1135810048 16:25578753-25578775 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
1135866849 16:26111173-26111195 GAGGCGGGAGGAAGATCAAGTGG - Intronic
1135920304 16:26643445-26643467 GTGGAGGGAAGAAGAGGAGGAGG - Intergenic
1135935107 16:26773237-26773259 GAGAAGTGGAGAAGCTGAAGTGG + Intergenic
1136138859 16:28276043-28276065 GCGGATGGAAGAAGTGGAGGAGG + Intergenic
1136367415 16:29815140-29815162 GAGGAGGCAGGAAGAGGAAGGGG - Intronic
1137003532 16:35251737-35251759 GAGGAGGCAAGAACGTGAGGAGG - Intergenic
1137512564 16:49114567-49114589 AAGAAGGGAAGCATTTGAAGAGG - Intergenic
1137825222 16:51489175-51489197 GAAGGGTGAAGAAGATGAAGAGG + Intergenic
1138278935 16:55758026-55758048 GAGGAAGAAAGAAGAAGAAGAGG - Intergenic
1139946313 16:70644841-70644863 AAGGAGGGAAGAGGAGGAAGAGG + Intronic
1140338098 16:74130684-74130706 AAGGAGGGAGGAAGGGGAAGAGG + Intergenic
1140642666 16:76994557-76994579 GAGGAGAGAAGAAAGGGAAGAGG + Intergenic
1140792705 16:78407686-78407708 CTGGAGGGAAGAAGTTGATGTGG - Intronic
1140870610 16:79102999-79103021 GAAGAGGGAAGAAGAGGATGAGG - Intronic
1141173251 16:81704254-81704276 GAGCAGGGAGGAGGGTGAAGGGG - Intronic
1141173300 16:81704377-81704399 GAGCAGGGAGGAGGGTGAAGGGG - Intronic
1141639396 16:85332780-85332802 GAGGAGAGAAGAGGCTGGAGGGG - Intergenic
1141804654 16:86334714-86334736 GAGGAGGGAAGACGGGGATGGGG + Intergenic
1142816220 17:2427999-2428021 AGGGAGGGAGGAAGTGGAAGAGG + Intronic
1142870411 17:2816131-2816153 GGGGAGGGAAGAGCTGGAAGAGG + Intronic
1143483234 17:7238890-7238912 CAGGAGGGAGGACGTAGAAGAGG - Intronic
1143576073 17:7794132-7794154 GAGGAGGGACAAAGGGGAAGAGG - Intronic
1143583232 17:7838408-7838430 GAGGAGGGAGGGAATAGAAGGGG + Intergenic
1143693167 17:8588059-8588081 GAGGAGGCAAGAAGGTGTGGTGG - Intronic
1145018469 17:19413398-19413420 AAGAAGGGAAGAAGGTGAGGGGG + Exonic
1146208738 17:30925526-30925548 GAAGAAGGAAGAAGAAGAAGAGG - Intronic
1146552983 17:33798091-33798113 CCGGAGGGAAGAAAATGAAGTGG + Intronic
1146642101 17:34549288-34549310 GAGGAGGGGAGAGGAGGAAGAGG + Intergenic
1147216323 17:38901233-38901255 GGGGAGGGAAGAAGAGGAGGTGG - Intronic
1147361523 17:39933795-39933817 GAGGAGGGGAGGAGTAGGAGTGG - Intergenic
1147874854 17:43613919-43613941 GAGGGAGGAAGAAGATGATGGGG + Intergenic
1148251850 17:46088478-46088500 GAATAGGGAAGGAGTTGAATGGG - Intronic
1148779220 17:50112220-50112242 GAGGAGGGGAGAGGGAGAAGGGG + Intronic
1149313046 17:55414527-55414549 GAGGAGGGTTCCAGTTGAAGGGG - Intronic
1149364665 17:55931036-55931058 GAGGAGGGAAGGAGGAGAAAAGG + Intergenic
1149406438 17:56356675-56356697 GAGGATGGAAGAAATTGAAATGG + Intronic
1149509496 17:57227661-57227683 GTGGAGGGAAAAAGTGGAAATGG - Intergenic
1149525504 17:57352455-57352477 GAGAAGGGAAGCAGATGAAGAGG + Intronic
1149956780 17:61060013-61060035 GAGGAAGGAAGAAAATGCAGGGG + Intronic
1150439407 17:65179178-65179200 GAGGAGGGTGGAAGTGGGAGGGG + Intronic
1150490204 17:65569057-65569079 GAGGACTGAAGAAGTGGCAGAGG - Intronic
1150947609 17:69765398-69765420 GGGGAGGGAAGAAGGGGGAGGGG - Intergenic
1151179445 17:72315968-72315990 CTGGAGGGAAGGAGTTGAACAGG - Intergenic
1151339674 17:73462787-73462809 GAGGTGGGAAGATGTTGGAGTGG - Intronic
1151903789 17:77034915-77034937 GGGCAGGGAAGAGGGTGAAGAGG + Intergenic
1152005537 17:77677997-77678019 GAGGAGAGAAGAAGATGGGGAGG - Intergenic
1152336710 17:79703085-79703107 GAGGAGGGGGGAAGAGGAAGAGG - Intergenic
1153601070 18:6781761-6781783 GAGAAGGAAAGAATTTGCAGAGG - Intronic
1153923435 18:9811512-9811534 GAGCAGGGAGGAAGGAGAAGTGG - Intronic
1154050393 18:10950713-10950735 GAAGAGGGAAGAGGAGGAAGGGG - Intronic
1154103458 18:11498948-11498970 GAGGAGGGAAGAAATTCCACTGG - Intergenic
1155066562 18:22273835-22273857 GAGGAGGGAAGAGGGGGAGGAGG - Intergenic
1155134512 18:22975592-22975614 GAGGAAGGAAGAAGTTCTACAGG - Intronic
1155545437 18:26909796-26909818 GAGGAGGGAAGAGGAGGAGGAGG + Exonic
1155656185 18:28195555-28195577 GAGGAGGGAGGGAGTGGTAGTGG + Intergenic
1156117858 18:33808540-33808562 GAGGAGGGAAGAGGATGGGGAGG - Intergenic
1156316318 18:35972359-35972381 GAGGCGGGAGGAAGATGGAGAGG + Exonic
1156493822 18:37512729-37512751 CAGGAGGGAAGAAGGAGAAAGGG - Intronic
1156604522 18:38650558-38650580 CAGGGGTGAAGAAGTTGGAGTGG - Intergenic
1156761009 18:40590436-40590458 GAGGAGGGAAGAAAAGGAAAGGG + Intergenic
1157399915 18:47378709-47378731 GAGGAGGAGAGAAGTAGGAGTGG - Intergenic
1157488675 18:48107407-48107429 AAAGAGGGAAGAAGAGGAAGAGG + Intronic
1157566205 18:48680734-48680756 GAGGAGGGAAGATGCTGGACCGG - Intronic
1157691947 18:49690925-49690947 GAGATGGGAGGAAGCTGAAGGGG - Intergenic
1157947277 18:51994588-51994610 TAGGAAGGAAGAACTTGAACTGG - Intergenic
1157987282 18:52452503-52452525 GAGTAGGGAATAAGGAGAAGAGG - Intronic
1158113822 18:53972415-53972437 GGGGATGGAAGGAGTTGATGGGG - Intergenic
1158305800 18:56103852-56103874 GAGGAGGGAAGGAGGGGAGGGGG + Intergenic
1158334572 18:56401949-56401971 GAGAAGGGAAGGAGGGGAAGTGG + Intergenic
1159149480 18:64502927-64502949 AAGGAGAAAAGAAGTTGAAAGGG - Intergenic
1159467528 18:68804008-68804030 GAGTAGGGAAAAGGTAGAAGTGG + Intronic
1160076263 18:75680519-75680541 GGGGAGGGAAGAAAGTGAGGTGG - Intergenic
1160898691 19:1415841-1415863 GAGGCGGGAAGAATTAGAGGCGG - Intronic
1161025080 19:2033011-2033033 GAGGAGGGCAGAGTTTGAGGGGG + Intronic
1161251705 19:3284410-3284432 GGGGAGGGAAGAAGTTGTCCAGG - Intronic
1161388489 19:4009148-4009170 GGGGAGGGAAGATGTGAAAGGGG - Intronic
1161389760 19:4014911-4014933 GAGGATGGAGGAAGTGGAGGAGG + Intronic
1161415748 19:4145498-4145520 GAGGAGGGAGGAGGCTGAGGAGG + Intergenic
1161638107 19:5401926-5401948 GAGGAGGGAAGAAGGAAGAGGGG + Intergenic
1161837021 19:6654745-6654767 GAGAGGGGAAGGAGATGAAGGGG - Intergenic
1161919785 19:7257454-7257476 GAGGAGGGAGGAGGGTGGAGTGG + Intronic
1161920918 19:7265072-7265094 GAGGTGGGAAGAAGTTAAGTGGG - Intronic
1162103076 19:8352432-8352454 GAGGAGGGAAGTTGTTTAAGAGG - Intronic
1162201248 19:9022152-9022174 GAAGAAGGAAGAAGAGGAAGAGG - Intergenic
1162792349 19:13069591-13069613 GAGGAGGAAAGAAGTGGGGGTGG + Intronic
1162836828 19:13325139-13325161 GAAGAAGGAAGAAGAAGAAGAGG - Intronic
1163204256 19:15790665-15790687 GAGGAGGGATGAAGAAGAGGAGG + Intergenic
1163386104 19:17001508-17001530 GGGGAGGGAAGAACTTAGAGTGG + Intronic
1163398286 19:17076507-17076529 GAGGAGGGAAGAGAAGGAAGGGG + Intronic
1163643224 19:18473688-18473710 GAAGAGGGAAGAAGATGCAGAGG - Intronic
1163739141 19:18999963-18999985 GAGAAGGGGAGAAGATGGAGTGG - Intronic
1164146613 19:22516637-22516659 GAGGAGAGAGGAAGTGGAAATGG - Intronic
1164302363 19:23973154-23973176 GAGGAGGAAACAAGAAGAAGAGG + Intergenic
1164612442 19:29641760-29641782 GAGGAGGAAAGAAGAAAAAGAGG + Intergenic
1164870377 19:31638584-31638606 GTGGAGGGAAGAAGAGGAAAAGG + Intergenic
1164955810 19:32383099-32383121 GAGCAGGAAAGCAGTAGAAGAGG + Exonic
1165122746 19:33571956-33571978 GAGGAGGGATGAAGATGTATAGG + Intergenic
1165416045 19:35694128-35694150 GAGGAGGGAGGAAGAGGAAGAGG - Intergenic
1165743921 19:38219147-38219169 CAGGAGGGAAGAGGCTGCAGAGG + Intronic
1165796632 19:38523663-38523685 GAGGAAGAAAGAAATGGAAGAGG - Intronic
1165977562 19:39690353-39690375 ACGAATGGAAGAAGTTGAAGAGG + Intergenic
1166212499 19:41316114-41316136 GAGGAGGGAAGAGGTGGAGGAGG - Intronic
1166674923 19:44734586-44734608 GAGGAGGGAGGAAGAGGAAGAGG - Intergenic
1167191249 19:47991610-47991632 GAGGAGGGAAGAGGAGGAAGAGG - Intronic
1167324093 19:48813361-48813383 GAGGGGGGAAGGAGGTCAAGAGG + Intronic
1167601416 19:50457201-50457223 GAGGAGGGAGGAAGCTGATGAGG - Intronic
1167674403 19:50875472-50875494 GAGGAGGGAGGAAGGAGAAGGGG + Intronic
1167707876 19:51092407-51092429 GAAGATGGAAGAAGTTCCAGGGG - Intergenic
1167775580 19:51552584-51552606 GAGTAGGGAAGAAGAGGGAGAGG + Intergenic
1168249708 19:55134767-55134789 GAGGAGGGAAGAAGAAGGGGAGG + Intronic
1202643673 1_KI270706v1_random:121864-121886 GAGGAGGGGGGCACTTGAAGGGG + Intergenic
924965897 2:76322-76344 CAGTAGGGAAGAGGTAGAAGAGG - Intergenic
925301618 2:2818337-2818359 GAGGTGGGAAGAAGTTAAAATGG + Intergenic
925993552 2:9273208-9273230 GATGATGTAAGAAATTGAAGAGG - Intronic
926087765 2:10030694-10030716 GAGGAGGGAAAAGGGGGAAGGGG + Intergenic
926121754 2:10245057-10245079 GAAGAGGGAAGAGGTGGATGGGG + Intergenic
926317777 2:11724220-11724242 GAGGAGAGAAAGAGATGAAGAGG - Intronic
927555054 2:24025298-24025320 TGGGAGGGGAGGAGTTGAAGAGG + Intronic
927954268 2:27197634-27197656 GAGGAGGGACTAAGGAGAAGAGG + Intergenic
927987595 2:27423667-27423689 GAATAGGCAAGAAATTGAAGAGG - Intergenic
928118102 2:28562680-28562702 GAGGAGGGAAGAAATTGCCATGG - Intronic
928431701 2:31224436-31224458 AAGGGGTGAAGAAGTTGAGGTGG + Intronic
928467669 2:31537878-31537900 GAGGAAGGCAGAAGGTGAAAGGG - Intronic
928973466 2:37057398-37057420 GAGGAGGGAAGTAGTTGTGTTGG + Exonic
929007096 2:37406468-37406490 GAGTAGGAAAGAAGATGCAGTGG + Intergenic
929355855 2:41023442-41023464 GAGAATGGTAGAGGTTGAAGAGG - Intergenic
929431738 2:41893196-41893218 GGGGAGGGAGGAAGGGGAAGGGG - Intergenic
929701982 2:44169689-44169711 GAGTAGGGCAGAAGCTGATGAGG - Intronic
929957701 2:46471326-46471348 GGGGATGGAAGAAGTACAAGAGG - Intronic
930752194 2:54945032-54945054 GAGGAGGGAAGGAGTGAAGGAGG - Intronic
930806738 2:55497906-55497928 GAGGAGGGAGGAAGAGGGAGAGG + Intergenic
930993017 2:57683350-57683372 GGGGAGGGAAGAGATTAAAGAGG - Intergenic
931362564 2:61590468-61590490 GAAGAAGGAAGAAGAAGAAGAGG + Intergenic
931920248 2:67007553-67007575 GAGGAGTGACTAAGTGGAAGTGG + Intergenic
932176117 2:69604433-69604455 GAGGAGAGAAACAGTTGGAGAGG - Intronic
933238855 2:79896947-79896969 GAGGAGAGACGAAGTTTGAGAGG + Intronic
933411493 2:81930774-81930796 GAGGAAGGAAGAACTTGACAGGG - Intergenic
933500886 2:83109710-83109732 AATGAGGGAAAAAGATGAAGGGG - Intergenic
933885054 2:86711538-86711560 GACTAGGGAAGAAGCTGATGAGG + Intronic
933925120 2:87085146-87085168 GACTAGGGAAGAAGCTGATGAGG - Intergenic
934128032 2:88917391-88917413 GAGGAGGACAGAAGTAGAGGTGG + Intergenic
934506105 2:94895779-94895801 GAGGAGGGGAGCAGTTGAAGGGG + Intergenic
934514024 2:94973224-94973246 GAGGAGGGAAGATGTAGGAAGGG - Intergenic
935259567 2:101343084-101343106 GAGGAGGGAAGAGGCTGACTGGG - Intergenic
935502759 2:103861232-103861254 GGGGAGGGAAGAAGTAGAATTGG + Intergenic
936167907 2:110139895-110139917 GAGGAGAGAGGATGTTGAAATGG + Intronic
936462051 2:112721355-112721377 GTGGAGGGAAGGAAGTGAAGAGG - Intergenic
936468417 2:112776008-112776030 GAGAAGGGAAAAAGTAGGAGAGG - Intronic
936537076 2:113320782-113320804 GAGGAAGGAAGAAAGAGAAGAGG - Intergenic
936855105 2:116948318-116948340 GAAGAAGGAAGAAGATGAACAGG + Intergenic
936917560 2:117655459-117655481 GCTGAGGGAAGAAGGTGGAGAGG + Intergenic
937327858 2:121002791-121002813 GAGGAAGGAAAAATTTGAGGGGG + Intergenic
937788311 2:125928577-125928599 AAGAAGGCAAGAAGTTAAAGGGG + Intergenic
937982367 2:127623119-127623141 GAGGAGGGAGGTAGTGGATGGGG + Intronic
938771717 2:134506606-134506628 TAGGAGGGAGGCAGTTGAATGGG - Intronic
939015967 2:136904073-136904095 GAGGAGGGAAGAATAAGAGGAGG + Intronic
940293399 2:152098902-152098924 GAGGAAGGAAGAGGAGGAAGAGG + Intronic
940306759 2:152235162-152235184 GGGCAGGGAAGAAGTAGAGGGGG + Intergenic
940588132 2:155683293-155683315 GAGGAGGGGAGATGATGAAGAGG + Intergenic
940681511 2:156791306-156791328 GAGGTGGGAAAAAGATCAAGAGG + Intergenic
940764241 2:157772670-157772692 GTGGTGGGAAGACATTGAAGGGG - Intronic
941893002 2:170601648-170601670 GAGGAGGACAGAAGATGAAGAGG - Intronic
941904820 2:170710637-170710659 AAGAAAGGAAGAAGGTGAAGGGG - Intergenic
942004415 2:171683714-171683736 GAAGAGGAAGGAATTTGAAGGGG - Intergenic
942012990 2:171782774-171782796 GAGTAGGGATGATGTTAAAGTGG + Intergenic
942280366 2:174356611-174356633 AAGGAAGGAAGAAGGGGAAGGGG + Intronic
942963397 2:181860010-181860032 GAGGAGGAACCTAGTTGAAGTGG - Intergenic
943358407 2:186888085-186888107 GAAGAAGAAAGAAGATGAAGAGG - Intergenic
944093639 2:195942389-195942411 GAAGAAGGAAGAAGATGAAGAGG + Intronic
944093643 2:195942420-195942442 GAAGAAGGAAGAAGATGAAGAGG + Intronic
944330328 2:198458024-198458046 TAGAAGGAAAGAAGTAGAAGAGG - Intronic
944511611 2:200471448-200471470 CAGGAGGAAAGGAGGTGAAGGGG - Intronic
944531523 2:200672697-200672719 GCTAAGGGAAGAAGTAGAAGTGG + Intronic
944923331 2:204437813-204437835 GAGGAAGGAAGAATGTGGAGTGG + Intergenic
944933961 2:204547414-204547436 GAGGAGGGAAAAAATTAAAGTGG + Intronic
945209025 2:207363301-207363323 GAGAAGGGAAGAGAATGAAGAGG + Intergenic
945397593 2:209339295-209339317 GAGAAGGGAAGCAGTTGAATGGG - Intergenic
945504151 2:210617297-210617319 TCAGAGGGAAGAAGTTCAAGAGG - Intronic
945744799 2:213707255-213707277 GGGGCAGGATGAAGTTGAAGAGG - Intronic
945824154 2:214699554-214699576 GAGGAGGAAAGGACTTGAAAGGG + Intergenic
946196420 2:218035095-218035117 GCGCAGGGAAGAAGTGGTAGAGG - Intronic
946553089 2:220823853-220823875 GAGGGAGGAAGAAGAGGAAGGGG - Intergenic
946846649 2:223864908-223864930 GAGGAAGGAAGAAGTGGAGGAGG - Intronic
947099139 2:226600504-226600526 GAGGATGGAGGAGGTGGAAGAGG + Intergenic
947313922 2:228834252-228834274 TTGAAGGGAAGAAGTTGTAGAGG - Intergenic
947481091 2:230500674-230500696 GAGGAGAGAAGAGTTAGAAGTGG + Intronic
947760951 2:232603440-232603462 GAGGAAGGAAGAAGAAGAGGAGG + Intergenic
947861971 2:233366809-233366831 GAGGTGGGCAGAAGAGGAAGAGG + Intronic
948091855 2:235301953-235301975 GAGGAGGGAGGAGGATGAGGAGG - Intergenic
948091860 2:235301969-235301991 GAGGAGGGAGGAGGATGAGGAGG - Intergenic
948091868 2:235301992-235302014 GAGGAGGCAGGAGGATGAAGAGG - Intergenic
948149247 2:235731938-235731960 GCGCAGGGAAGAAATGGAAGGGG + Intronic
948266359 2:236637931-236637953 GAGGAGGGAAGGAGGTGGAGAGG - Intergenic
948875540 2:240825358-240825380 GAGGAGGAGGGAAGATGAAGTGG - Intergenic
949036006 2:241816021-241816043 GAGGAGGGCAGAGGTGGGAGGGG - Intronic
949077948 2:242073313-242073335 GTGGAGGGAGGGACTTGAAGGGG + Intergenic
1169047480 20:2545794-2545816 GAAGAAGGAAGAAGAAGAAGAGG + Intronic
1169256856 20:4106261-4106283 GGGGAGGGATGAGGCTGAAGAGG + Intergenic
1169520269 20:6363917-6363939 GCAGAAGTAAGAAGTTGAAGGGG - Intergenic
1169526351 20:6430361-6430383 GAGGATGAAAGAAGTGGAAGAGG - Intergenic
1169555303 20:6743273-6743295 GAGTAGGGAAGAAGGTGATCAGG - Intergenic
1169680571 20:8208002-8208024 GGGGAAGGAAGAGGTTGAGGAGG + Intronic
1169798358 20:9490347-9490369 GAGTAGGGAAGAATTTGGAAGGG - Intergenic
1170491597 20:16881589-16881611 GCTGATGAAAGAAGTTGAAGAGG - Intergenic
1170512876 20:17097140-17097162 GGAGTGGGAAGAAGTAGAAGAGG - Intergenic
1170560787 20:17556663-17556685 GAGGAGGGAAAGAATTGCAGGGG + Intronic
1171010848 20:21508731-21508753 GAGAGGGGAAGAAGGAGAAGGGG - Intergenic
1171108345 20:22457465-22457487 GAGGAAGGAAAAAGTTGGAAGGG + Intergenic
1171258384 20:23709690-23709712 TAGGAGGGAAGAAGTGGATAGGG - Intergenic
1172054834 20:32146872-32146894 GGGGAGGGATGAAGTTGGATGGG + Intronic
1172512266 20:35508950-35508972 GAGAACGGAGGAAGCTGAAGAGG + Exonic
1172900041 20:38328050-38328072 GGGGTGAGAAGAAGTTGAAGCGG - Intronic
1173006337 20:39142463-39142485 GAGGGGGGAAGAAGACGAGGAGG + Intergenic
1173326009 20:42034396-42034418 GAGGAGGAAAGAGGGAGAAGGGG + Intergenic
1173523372 20:43715144-43715166 GAGGCTGGAAGAGTTTGAAGGGG - Exonic
1173535012 20:43802865-43802887 GAGGAGGGAAGAAATGGACATGG - Intergenic
1173734565 20:45350021-45350043 GTTGAGGGAAGAAGTGGAGGGGG + Intergenic
1173734938 20:45353751-45353773 GAGAATGGAATAAGGTGAAGTGG + Intergenic
1173976267 20:47188976-47188998 GGGGAGGGAGGAAGGAGAAGAGG + Intergenic
1174157255 20:48523738-48523760 GAGGAGGGGAGAAAGTGAGGGGG - Intergenic
1174755882 20:53158208-53158230 GAGGAAGGCAAAAGTGGAAGAGG + Intronic
1174898557 20:54475548-54475570 GAGGAGGAAAGAGGAGGAAGGGG - Intergenic
1175183983 20:57167441-57167463 CAGGAGGGGGGAAGATGAAGAGG + Intergenic
1175275195 20:57763687-57763709 GAGGATGGGAGAAGCTGAGGTGG + Intergenic
1175670020 20:60893916-60893938 GTGGGGGGAAGAAATTGAGGAGG + Intergenic
1175692518 20:61075814-61075836 GAAGGGGGAAGAAGGAGAAGGGG + Intergenic
1176037864 20:63049144-63049166 GAGGAGGGAGGAAGAGGAGGAGG - Intergenic
1176200029 20:63855911-63855933 GGGGAGGGGAGAAGGTGCAGGGG + Intergenic
1176620124 21:9050555-9050577 GAGGAGGGTGGCACTTGAAGGGG - Intergenic
1176956065 21:15105388-15105410 GAAGAGGGAAGAGGAAGAAGAGG - Intergenic
1176961988 21:15169398-15169420 GAGAAAGGAAGAAGTTGATGTGG + Intergenic
1176991389 21:15501256-15501278 GAACAGTGAAGAAATTGAAGAGG + Intergenic
1177587701 21:23119720-23119742 TAGTAGGGAAGAAGATAAAGAGG - Intergenic
1177662386 21:24102221-24102243 AAGGAGGGAAGAAGGGAAAGAGG + Intergenic
1177729838 21:25014648-25014670 GAAGTGTGAAGAAATTGAAGAGG - Intergenic
1177850337 21:26339361-26339383 GCTGATGAAAGAAGTTGAAGAGG + Intergenic
1178420759 21:32441515-32441537 GAGGCTGGATGAAGTAGAAGGGG + Intronic
1178791592 21:35705191-35705213 GGGGAGGGAAGAAGGAGAAAAGG + Intronic
1179025185 21:37673819-37673841 GTGGAGGAAAGAAGGGGAAGGGG + Intronic
1179046126 21:37846874-37846896 GAGGAGGGGGGAAGGTGAGGAGG - Intronic
1179163848 21:38919755-38919777 AAGGTGGGAAGAAGTTGAGCTGG - Intergenic
1179488599 21:41726553-41726575 GAGGGAGGAAGAAGAAGAAGGGG - Intergenic
1179904077 21:44413147-44413169 GAAAAGGGAAGATGTTGCAGAGG - Intronic
1180070849 21:45435246-45435268 GAGGAGAGAAGAGGAAGAAGGGG + Intronic
1180358291 22:11860569-11860591 GAGGAGGGGGGCACTTGAAGGGG - Intergenic
1180379971 22:12131761-12131783 GAGGAGGGGGGCACTTGAAGGGG + Intergenic
1180943817 22:19678834-19678856 GAGGAGGGAAGAAGAGGACTCGG + Intergenic
1181886079 22:26023489-26023511 GAGGAGGGAGGAGGTAGAGGAGG - Intronic
1183054486 22:35295203-35295225 GAGAAGGGAAGAAATTAAATAGG - Exonic
1183057351 22:35315139-35315161 GAGGAGGGAAGAAGCTGAGGCGG + Intronic
1183108338 22:35630299-35630321 GAGGAGGGAAGGAGGCGGAGGGG + Intronic
1183328158 22:37205469-37205491 GAGGAAGGGAGAAGAGGAAGAGG - Exonic
1183597597 22:38822027-38822049 GAGGAGGAAAGAGGAGGAAGAGG + Exonic
1183713829 22:39522011-39522033 GAGGTTGTAAGAAGGTGAAGGGG - Exonic
1183785161 22:40024985-40025007 GCGGAGGGAAGACGTAGAAGAGG - Intronic
1183848452 22:40562699-40562721 GAAGAGGGAAGGAGGGGAAGGGG + Intronic
1184345968 22:43913140-43913162 GAAGAAGGAAGAAGAAGAAGAGG - Intergenic
1184412408 22:44332638-44332660 GAGGGGAGAAGAAGCCGAAGAGG - Intergenic
1184449797 22:44576092-44576114 GAGGAGGGAGGAGGTAGAGGAGG + Intergenic
1184526680 22:45028013-45028035 GAGAGGGGAAGAAGAGGAAGGGG + Intergenic
1184629811 22:45767702-45767724 GAGGAAGGAAGAAGGAGAAAAGG + Intronic
949834003 3:8248362-8248384 GAGAAGGGAAGAAGTAGAACTGG + Intergenic
951608636 3:24465935-24465957 TAGGAAGGAAGAAATGGAAGGGG - Intronic
952861518 3:37816662-37816684 GCAGAGGGGAGAAGGTGAAGAGG + Intronic
953128257 3:40112265-40112287 GAGGAGGGAAGAAGAGCAAAGGG + Intronic
953490650 3:43347588-43347610 CAGGGTGGAAGAAGATGAAGAGG + Exonic
953573799 3:44096540-44096562 GAGAAGGGAAGCAGTTGAGAAGG - Intergenic
954001717 3:47562765-47562787 GAAGAGGGAAAAAGTTGGGGGGG + Intronic
954711926 3:52509416-52509438 GAGGAGGGACGAAGGCCAAGGGG + Intronic
954711949 3:52509502-52509524 GAGGAGGGACGAAGGCCAAGGGG + Intronic
955066082 3:55534767-55534789 GAAAAGGGAAGAATTTGAATAGG - Intronic
955619723 3:60849905-60849927 TAGAAGAGAAGAAGTAGAAGTGG - Intronic
956198819 3:66684052-66684074 GAGGGGGGAAGGAGAAGAAGAGG - Intergenic
956464031 3:69500812-69500834 GGGGAGGGAGGAAGTAGAAAAGG + Intronic
957498134 3:81017273-81017295 GAGGAGGTAAGGTGTGGAAGGGG - Intergenic
957988639 3:87603148-87603170 GAAGAGGGTAGAAGCTAAAGAGG - Intergenic
958048688 3:88318112-88318134 GAGGAGAGAACCAGATGAAGAGG + Intergenic
959049654 3:101512845-101512867 GAGGAGGGAAAAAATAAAAGGGG + Intronic
959494168 3:107030063-107030085 GATGAGGGAATGAGTTGCAGTGG - Intergenic
959894856 3:111594174-111594196 GAGGCGGGAAGACGAGGAAGAGG - Exonic
960305222 3:116052235-116052257 GAGGAGGACAGAAGTAGAAGTGG + Intronic
960323157 3:116262733-116262755 GAGCAAGGAAAAAGTTGAAGGGG + Intronic
961343917 3:126248674-126248696 GAGGAGGGAAGAAGTCAAACGGG - Intergenic
962422018 3:135237490-135237512 GAGAAGAGAAGAAGAGGAAGAGG - Intronic
962951046 3:140219228-140219250 GAGTAGGGAAGAGGGTGCAGAGG + Intronic
963039010 3:141055231-141055253 GCGGAGGGAAGAGGATGTAGTGG + Intronic
964817544 3:160732550-160732572 GAGAAGAAAAGAAGTTGAATTGG - Intergenic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
964844685 3:161032599-161032621 GAAGAGGGAGGAAGTAGAGGTGG + Intronic
965656430 3:170989643-170989665 GAGGAGAGAGGCAGTTGCAGTGG - Intergenic
966087361 3:176084751-176084773 GAGGAGGGAGGAAGGAGGAGGGG + Intergenic
966142175 3:176769011-176769033 GAGGAAGGAAGAAGAGGAGGAGG + Intergenic
966513753 3:180794100-180794122 AATGATGGAAGAAATTGAAGAGG - Intronic
967316823 3:188157688-188157710 GGGGAGGGAAAAAGGTGGAGTGG + Intronic
967447981 3:189589278-189589300 GAGGAGAGAACAAGTTGAACAGG + Intergenic
967471402 3:189866207-189866229 GAGGAGGAAAGAAGAAGAAGTGG + Intronic
967682724 3:192383749-192383771 GAGGAGGGAAATATTAGAAGAGG + Intronic
967839546 3:193994156-193994178 GAGGGGGGAAGTAGTTGATGAGG - Intergenic
967950135 3:194834318-194834340 CAGGTGGGAGGCAGTTGAAGAGG + Intergenic
968096148 3:195932152-195932174 GAGGAGGGAGGAGGATAAAGAGG + Intergenic
968948590 4:3678593-3678615 GAGGAGGAGGGAAGTTGAGGAGG + Intergenic
968952057 4:3700343-3700365 GAGGAGGGGAGGAGTGGAGGAGG + Intergenic
969076162 4:4579362-4579384 GGGGAGGGAAGAATTAGGAGCGG - Intergenic
969492544 4:7508226-7508248 GAGGAGGGATGAAGGTCAGGAGG + Intronic
969533380 4:7741491-7741513 GAGGAGGGAGGAGGAGGAAGGGG - Exonic
969561507 4:7950955-7950977 GAGCAGGGAGGAAGAGGAAGGGG + Intergenic
970124633 4:12795409-12795431 GAGGAGAAGAGAGGTTGAAGAGG + Intergenic
970156000 4:13142317-13142339 GAGAAGGGAAGAGGGAGAAGGGG + Intergenic
970319279 4:14859922-14859944 GAGGTGGGGAGGAGATGAAGGGG + Intergenic
970793125 4:19882577-19882599 GAGGAGGGAATAAGGTTAACAGG - Intergenic
971234650 4:24829968-24829990 AAGAAGGGAGGAGGTTGAAGAGG + Intronic
971646317 4:29209231-29209253 GAGGAGGGCAGAAGGAGAAGAGG - Intergenic
971895952 4:32594230-32594252 TATGAGTGAAGAAGTTGAAAAGG + Intergenic
972127764 4:35790282-35790304 GAGGAGGAAAGGAGAAGAAGAGG + Intergenic
972359361 4:38313463-38313485 GAGGAGGGTAGAAATTGGAGTGG + Intergenic
973089341 4:46112996-46113018 GGGGAGATAAGAATTTGAAGTGG - Intronic
973910167 4:55572061-55572083 GAAGGAGGAAGAAGTGGAAGAGG - Intronic
974887260 4:67834860-67834882 GAAAAAGGAAGAAGTTGTAGTGG - Intronic
974980781 4:68954828-68954850 GAGGAGGAAAGTCTTTGAAGAGG - Intergenic
975046447 4:69809847-69809869 GAAGAAGGGAGAAGTTGAACAGG + Intergenic
975050232 4:69854239-69854261 GAGGCAGGAAGAAGTTCAGGTGG + Exonic
975328578 4:73087963-73087985 AAGGAGGGAAGAAGGAAAAGGGG + Intronic
975617118 4:76257553-76257575 GAGCAGGGGTGAAGTTGGAGAGG - Intronic
975701971 4:77075614-77075636 GAGGAGGGAGAAAGGGGAAGCGG + Exonic
976130896 4:81882823-81882845 GAGCAGGCAAGAAAGTGAAGGGG - Intronic
976154303 4:82126053-82126075 GAGGGGGGCAGGAGTGGAAGGGG - Intergenic
976527213 4:86107586-86107608 AAGGGGGGAAGGAGTAGAAGAGG + Intronic
976794157 4:88913430-88913452 GAAGAGGGAAGAAGAGGAGGAGG + Intronic
977408979 4:96636980-96637002 GAGAATGGTAGAAGTTGAAAAGG - Intergenic
977540802 4:98316521-98316543 GATGATGGCAGGAGTTGAAGGGG + Intronic
977731786 4:100362531-100362553 GAGGAGAGAGGAAGTTAAGGTGG + Intergenic
977894594 4:102349258-102349280 GAGAAGGGAAGAAGAGAAAGGGG - Intronic
977988381 4:103413017-103413039 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
979979543 4:127237585-127237607 GAGGAGGGAAGGAATTGGGGAGG + Intergenic
980518031 4:133890071-133890093 GAGCAGGGCAGTACTTGAAGTGG - Intergenic
980709341 4:136543870-136543892 GAGGAGGGAAGACGGTAATGAGG + Intergenic
980806757 4:137825365-137825387 GATGAGAGATGCAGTTGAAGAGG + Intergenic
981061483 4:140429777-140429799 GAGGTGGGAGGAAGCTGAGGTGG + Intergenic
981102485 4:140844766-140844788 AATGAGGGCAGAAGATGAAGTGG - Intergenic
981219395 4:142213857-142213879 GAGGAGGAAAGAACTTGCACTGG - Intronic
981248610 4:142571117-142571139 GAGTGGGGCAGAAGGTGAAGAGG + Intronic
981488775 4:145317750-145317772 GAGGAGTGAAAAAGTTGATGTGG - Intergenic
981891271 4:149740889-149740911 GTAGAGGGGAGAAGCTGAAGAGG + Intergenic
982154081 4:152498056-152498078 GGGGAGGGAAGAACTTTAAAAGG + Intronic
982420992 4:155197417-155197439 AAGGAAGGAAGAAGTGGGAGAGG - Intergenic
983046120 4:162988450-162988472 TAGGAAGGAAGAAGTTAAATTGG - Intergenic
983718636 4:170817154-170817176 AAGCATGGAAGAAGGTGAAGAGG - Intergenic
984024353 4:174524832-174524854 GAGGAGGGAAAGGGATGAAGGGG - Intergenic
984237064 4:177172417-177172439 GAGGAGGGAAGAAGGGAAAACGG - Intergenic
984683273 4:182636085-182636107 GTGAAGGGAAGAAGCTGTAGTGG - Intronic
984728371 4:183042651-183042673 GGGGAGGGAAGTAGGGGAAGTGG - Intergenic
984863168 4:184257547-184257569 AAGGAGGGAAGGAGTGGGAGTGG + Intergenic
984888483 4:184472655-184472677 CCGGAGGGAGGAGGTTGAAGAGG + Intronic
985085902 4:186312114-186312136 GAAGAAGGAAGAAGAAGAAGAGG - Intergenic
986009610 5:3700378-3700400 GAGGATGAAAGAAGTTCTAGAGG + Intergenic
986601046 5:9473612-9473634 AAGGAGGGAAGGAGCTGAAGAGG + Intronic
986830568 5:11572589-11572611 GAGGAGGGAAGAAGTTGAAGTGG - Intronic
988418312 5:30974452-30974474 GAGGAGGGAAGGAGTTGCAGAGG - Intergenic
988680761 5:33481376-33481398 GAGAAGGGAAGGGGATGAAGGGG - Intergenic
990309031 5:54519885-54519907 GACGAGGGTAGAATTAGAAGGGG + Exonic
990407262 5:55503884-55503906 GAGGGGGGAGGAAGTAGAGGGGG + Intronic
990473448 5:56139421-56139443 GTGGAGGGAAGAATTTGGAAAGG + Intronic
990565710 5:57026436-57026458 TATGGGGGAAGAAGTAGAAGGGG + Intergenic
990589656 5:57249775-57249797 GAGGGGGGAAGGAGGGGAAGGGG - Intronic
990597899 5:57329628-57329650 GGGAAGGGAAGAAGGAGAAGGGG + Intergenic
990766197 5:59186048-59186070 GAGGAGGGAAGAAGGAGATAAGG - Intronic
991247657 5:64525139-64525161 GAGGAGGGAGGAAGTTGAAATGG - Intronic
991510639 5:67373124-67373146 GAGGATGGGGGAAGTAGAAGAGG - Intergenic
991900627 5:71456084-71456106 GAGCAGGTAAGAGGTTGCAGAGG + Exonic
991955810 5:71995015-71995037 GAGAAGGGAAGAGGTTGTTGTGG + Intergenic
992529064 5:77638112-77638134 GAGGAGAGAAGAAGATGGTGGGG + Intronic
992558264 5:77924505-77924527 GGTGAGGGCAGAAGGTGAAGCGG - Intergenic
992667668 5:79027071-79027093 GACTAGGGAAGAAGTGGGAGGGG - Intronic
993318879 5:86446810-86446832 GAGGAGATGAGAAGTTGAAAAGG - Intergenic
993511457 5:88776490-88776512 GAGGCTGGAAGAGGTTGATGAGG - Intronic
993564982 5:89462929-89462951 TAGGAGGGATTAAGATGAAGGGG + Intergenic
994070791 5:95599568-95599590 GAGGAGAAAAGAGGTTAAAGAGG - Intronic
994349002 5:98722961-98722983 AATGAGGGAAGAAGTTTAAATGG - Intergenic
995060037 5:107803574-107803596 GACCAGGGAAGAAGTAGAAATGG + Intergenic
995217085 5:109607842-109607864 CAGGAGGGAAGAAATGGAAGTGG + Intergenic
995771245 5:115672780-115672802 GAGGAGGGGAGGAGAAGAAGAGG + Intergenic
995996325 5:118304830-118304852 AAGGAGGGAAGGAGGGGAAGAGG + Intergenic
997237391 5:132280912-132280934 GAAGAGGAAAGAAGAAGAAGAGG - Intronic
997339346 5:133130613-133130635 GAGAAGAGAGGAAGTGGAAGGGG - Intergenic
997518529 5:134507225-134507247 GAGAAGGGAGGAAGCTGAAGGGG + Intergenic
998308937 5:141107584-141107606 GGGAAGGGAAGAAGGAGAAGAGG + Intronic
998475829 5:142420805-142420827 GTGGAGGGAGAAACTTGAAGGGG - Intergenic
998480328 5:142457918-142457940 GAAGGAGGAAGAAGGTGAAGGGG - Intergenic
998490166 5:142539598-142539620 GAGGAGGGAAGAAGAGGAGAAGG - Intergenic
998993402 5:147844083-147844105 GAGGATGGAAAAAATTGCAGAGG - Intergenic
999261398 5:150241042-150241064 GAGGAGGGAAGAAGTCCTATTGG - Intronic
999337056 5:150729868-150729890 GAGGAGGGAAGAAGGGAAAGAGG - Intronic
999347019 5:150832497-150832519 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
999501296 5:152149115-152149137 GTGGTGGGAAGAAGGGGAAGAGG - Intergenic
999692686 5:154162373-154162395 AAGGAGGGAAGAAGGAGAAAAGG + Intronic
999744995 5:154585074-154585096 TAGGATGGCAGAAGTAGAAGAGG - Intergenic
1000444074 5:161298618-161298640 GAGCAGGGAAGAAACTCAAGAGG - Intronic
1001049550 5:168403538-168403560 GAGGAGAGAAAAGGTTGATGAGG + Intronic
1001132931 5:169079629-169079651 GAGGAGGGAAGAGGAGGAGGAGG + Intronic
1001132936 5:169079645-169079667 GAGGAGGGAAGAGGAGGAGGAGG + Intronic
1001132941 5:169079661-169079683 GAGGAGGGAAGAGGAGGAGGAGG + Intronic
1001132946 5:169079677-169079699 GAGGAGGGAAGAGGAGGAGGAGG + Intronic
1001132951 5:169079693-169079715 GAGGAGGGAAGAGGAGGAGGAGG + Intronic
1001132956 5:169079709-169079731 GAGGAGGGAAGAGGAGGAGGAGG + Intronic
1001132963 5:169079741-169079763 GAGGAGAGAAGAGGAGGAAGAGG + Intronic
1001290534 5:170455307-170455329 GAAGAAGGAAGAAGAAGAAGGGG - Intronic
1002334092 5:178466177-178466199 GAGGAGGGAGGAGGCTGGAGAGG - Intronic
1002482213 5:179510109-179510131 GAGGGGAGAAGAAGAGGAAGAGG - Intergenic
1002522391 5:179798941-179798963 GAGGTTGGAAGAAGCGGAAGCGG + Exonic
1002712169 5:181201933-181201955 GAGGAGGGATGAAGGTCTAGAGG + Intronic
1002726113 5:181297607-181297629 GAGGAGGGAAGGAGGGGAAAAGG - Intergenic
1003348313 6:5292087-5292109 CAGGAGGTAAGCAGGTGAAGGGG + Intronic
1003359766 6:5413643-5413665 AAGGAGTGAAGGAGTTAAAGTGG - Intronic
1003636904 6:7840312-7840334 TTGGAGAGAAGCAGTTGAAGAGG + Intronic
1003679909 6:8242785-8242807 AAGCAGAGAAGAAGTTGAAGTGG - Intergenic
1004155193 6:13161333-13161355 GAGGAGGGAGGAGGAAGAAGAGG - Intronic
1004325549 6:14670971-14670993 GAGGACAGATGAAGATGAAGAGG + Intergenic
1005490311 6:26341860-26341882 GAGGAGGGAAAAAGCTGGGGCGG + Intergenic
1006187714 6:32190190-32190212 GAGGAGGGAGGAGGGAGAAGGGG + Intergenic
1006336357 6:33422845-33422867 GAGGAGGGAAGAGTTGGGAGGGG + Intronic
1006338698 6:33433910-33433932 CAGGAGGGCAGAAGATAAAGGGG - Intronic
1006671129 6:35730356-35730378 GAGGAGGGCAGAAGGTGGAAAGG + Intergenic
1006730375 6:36231559-36231581 GAGGAGAGAAGAAGGAGAAAAGG - Exonic
1007065555 6:38987307-38987329 GTACAGGGAAGAAGTAGAAGAGG - Intronic
1007104260 6:39272697-39272719 GAGGGGAGAAGAAGATAAAGGGG + Intergenic
1007258223 6:40543454-40543476 GTGGGAGGAAGAAGTTGGAGTGG - Intronic
1007939458 6:45765470-45765492 GAGGAGGGAAGAAGGGAAGGAGG - Intergenic
1009487962 6:64249377-64249399 GAAGAGTGAGGAAGTTGGAGGGG + Intronic
1010160814 6:72852616-72852638 GTGGAGAGAAGGAGATGAAGGGG + Intronic
1010710660 6:79170704-79170726 GAGAAGGGCAGAAGATGAGGGGG - Intergenic
1011154373 6:84313748-84313770 AAGGAGGGAAGGAGGAGAAGAGG - Intergenic
1011202848 6:84856486-84856508 GAGGAGGGATGTAGTTCAAGTGG - Intergenic
1011388324 6:86821966-86821988 GAAGAGGGAAGGAGCAGAAGTGG - Intergenic
1011417429 6:87137295-87137317 GAGGAGGGGAGGAGGGGAAGGGG - Intergenic
1011632376 6:89339627-89339649 GAGGAGGGAAGGAGTGGGGGAGG + Intronic
1011755054 6:90490154-90490176 GAGGAGGGAGGAGGTGGAAAAGG - Intergenic
1011910753 6:92434306-92434328 GGGAAGGGAAGAAGTTGGTGGGG - Intergenic
1012538363 6:100327588-100327610 TGGGAGGGAAGAAGTTAGAGTGG - Intergenic
1013339349 6:109198244-109198266 GAGAAGAAAAGAAGTAGAAGTGG - Intergenic
1014082184 6:117300522-117300544 AGGGAGGGAGGAAGTTGAAGAGG + Intronic
1014432561 6:121388198-121388220 GAGGAGGCGAGAAGTTAAAGGGG - Intergenic
1014656394 6:124110537-124110559 AAGGAGGGAAGAAGGAGATGTGG - Intronic
1014684402 6:124477789-124477811 GAGGAGGGGGGAAGGGGAAGAGG - Intronic
1014878031 6:126685458-126685480 GGGGAGGGGAGTAGTAGAAGAGG - Intergenic
1014955792 6:127614397-127614419 GAGGGGGAAAGAAGTAGAATTGG + Intergenic
1015353093 6:132246059-132246081 GAGGAGGGAGGGACTTGATGTGG + Intergenic
1015452008 6:133380874-133380896 GGGGAGGGAAGAAGAAGAAGAGG - Intronic
1015575065 6:134662378-134662400 GAGGATGGCACAAGTTGAAATGG + Intergenic
1016131982 6:140485334-140485356 CAGGAGGAAAGAAAATGAAGGGG - Intergenic
1017205442 6:151800225-151800247 GAGGAGGGAAGAGGGTCTAGGGG + Intronic
1018038073 6:159898643-159898665 GAGGAGGGAGGAGGAGGAAGAGG - Intergenic
1018204519 6:161424716-161424738 GAGGAGTGGAGAATTTGGAGAGG + Intronic
1018392432 6:163350685-163350707 GAGGAGGGAAGAAGGGGCAAGGG - Intergenic
1019223556 6:170493388-170493410 GAGGAGGGGAGGAGGGGAAGAGG + Intergenic
1019223571 6:170493434-170493456 GAGGAGGGCAGGAGGGGAAGAGG + Intergenic
1019266747 7:121478-121500 GAGGAGGGAAGATGGGAAAGAGG + Intergenic
1019319741 7:410191-410213 CAGGAGGGAAATAGGTGAAGAGG + Intergenic
1019551801 7:1606834-1606856 GAGGAGGGAAGGGGAAGAAGAGG - Intergenic
1020240399 7:6390018-6390040 AAGGAGGGAAGGAGTAGGAGAGG - Intronic
1020740417 7:12009301-12009323 GATGGGAGAAGCAGTTGAAGTGG + Intergenic
1020876585 7:13702456-13702478 GAGGAGGGAAGAAGGAGGAGAGG + Intergenic
1020954663 7:14726063-14726085 GAGGAGAGAACAAGTTGCACAGG + Intronic
1021234632 7:18127430-18127452 GAGCAGGGAAGCAGATAAAGGGG - Intronic
1021301641 7:18980777-18980799 GAAGAAGGAAGAAGAAGAAGAGG - Intronic
1021746736 7:23748535-23748557 AGAGAGGGAAGAAGTGGAAGGGG - Intronic
1021834598 7:24656849-24656871 TAGGAGGGAAGAATGAGAAGTGG - Intronic
1022293567 7:29027809-29027831 GCTGATGTAAGAAGTTGAAGAGG + Intronic
1022529405 7:31057643-31057665 GAGGAGGAAAGAGGTTCTAGAGG + Intronic
1023257119 7:38323019-38323041 GAGGAAGAAAGAAGTTCCAGAGG + Intergenic
1023482876 7:40653600-40653622 GAGGAGAGAAGAAACTGAAAGGG - Intronic
1023528519 7:41130060-41130082 GAGGAGGGAGGAAGGCAAAGTGG - Intergenic
1023948641 7:44823592-44823614 AAGGAGGGAAGAAGAAGGAGGGG - Intronic
1024019549 7:45353360-45353382 GGGGAGGGAAGAGGAGGAAGGGG + Intergenic
1024584527 7:50830214-50830236 GAGGAGGAAAGAAATGGAGGAGG + Intergenic
1024720927 7:52136947-52136969 GAGGAGGGAGGATGATAAAGAGG + Intergenic
1025117212 7:56268476-56268498 GAGGAGGGAAGGAGAGGAGGAGG - Intergenic
1025117217 7:56268492-56268514 GAGGAGGGAAGGAGAGGAGGAGG - Intergenic
1025117238 7:56268556-56268578 GAGGAAGGAAGGAGGGGAAGAGG - Intergenic
1025556750 7:62319016-62319038 GAGGAGGGAACAAGAATAAGAGG - Intergenic
1025970489 7:66319923-66319945 GAGGAGGGAATAATTTGGAGGGG - Intronic
1026191885 7:68136374-68136396 GAGGAGGGAAGAAGAAGAGAAGG + Intergenic
1026205669 7:68255320-68255342 GAGGAGGGGAGAAGGAGGAGGGG - Intergenic
1026205686 7:68255403-68255425 GAGAAAAGAAGAAGATGAAGAGG - Intergenic
1026469077 7:70679338-70679360 GAGAAGGGAAGAGGTAGAACTGG + Intronic
1026469167 7:70680115-70680137 GAGGAGGGTGGAAGCAGAAGAGG + Intronic
1026964557 7:74430994-74431016 GAGGAGGGAGGCAGGTGAGGAGG - Intergenic
1027163458 7:75818639-75818661 GAAGAGGGAAGCAGTAGAAGTGG + Intronic
1027176857 7:75909604-75909626 GAGGAAGGAAGAAGAAGAGGAGG + Intronic
1027192624 7:76005917-76005939 GAGGAGGGAGGAGGTGGAGGAGG + Intronic
1027254215 7:76420154-76420176 GAGGAGGGAAGAAGAGGAAGAGG - Intronic
1027621592 7:80493744-80493766 GAGGAGGAAAGAGGTGGAGGAGG - Intronic
1027621596 7:80493760-80493782 GAGGAGGAAAGAGGTGGAGGAGG - Intronic
1027621600 7:80493776-80493798 GAGGAGGAAAGAGGTGGAGGAGG - Intronic
1027769143 7:82384595-82384617 GAGAAGTGAAGAAGAAGAAGAGG + Intronic
1027771541 7:82413389-82413411 GAGGTGGGAAGACTCTGAAGAGG - Intronic
1028042583 7:86073517-86073539 GAAGAGGGAAAAAGAAGAAGAGG - Intergenic
1028064195 7:86361071-86361093 AAGGAGGGAACAAGGTAAAGAGG + Intergenic
1028213953 7:88109008-88109030 GAGTAGGGAAGAATATCAAGGGG - Intronic
1028224844 7:88238196-88238218 GGGGATGGAAGAAGTACAAGAGG - Intergenic
1028235309 7:88354179-88354201 GAGGTGGGGAGAAGATGAACAGG - Intergenic
1028306702 7:89274744-89274766 GAGAAGGGAAGAACTGCAAGTGG - Intronic
1028986535 7:97013381-97013403 GTGGAGGAAAGATGTCGAAGGGG + Intergenic
1029194245 7:98793612-98793634 GAGGAGGGAGGGAGCTGGAGGGG - Intergenic
1029708983 7:102289350-102289372 GAGGTGGGAAGAGGATCAAGGGG + Intronic
1030187238 7:106776183-106776205 GAGGAGGGAGGAAGAGGAGGGGG - Intergenic
1030552654 7:110983448-110983470 GAGAAGGGAAGAATATGAGGAGG - Intronic
1030632623 7:111912575-111912597 GAGGAGGGAGGAAGCAGAAGAGG + Intronic
1030648865 7:112095305-112095327 TAAGAGGGAAGAAGTTGGGGAGG + Intronic
1030881523 7:114886219-114886241 GGGGAGGGAAGAAGGGGAAAGGG + Intergenic
1030985945 7:116242215-116242237 GAGGGGGGAAGAAGGTGGAGTGG - Intronic
1031444066 7:121829155-121829177 GAGGAGAGAAGAGGGAGAAGAGG - Intergenic
1031484674 7:122312106-122312128 GAGGAGGGAGAGAGTTGAGGGGG + Intergenic
1031667499 7:124503084-124503106 AGGGAGGGAAGAAGGAGAAGAGG + Intergenic
1031866157 7:127040052-127040074 GAGGAGGGAAGAAGGGGAGATGG + Intronic
1031866175 7:127040093-127040115 GAGGAGGGAAGAAGGGGAGATGG + Intronic
1032195990 7:129788889-129788911 GAGGTGGGAGGAAGAGGAAGAGG - Intergenic
1032436750 7:131907130-131907152 GAGGAGGGAGGCTGCTGAAGTGG + Intergenic
1032770074 7:135043462-135043484 GAGGAGGGCAGAAGTGGAGATGG + Intronic
1032840535 7:135710273-135710295 GAGGATGGTAGAAGGCGAAGTGG + Intronic
1033496464 7:141902004-141902026 GAGGTGGGAGCAATTTGAAGTGG - Intergenic
1034179687 7:149127123-149127145 GAGGTGGGAAGACGCAGAAGGGG + Intronic
1034552804 7:151832221-151832243 GAGGAGGGAAGGAGAGGAGGAGG + Intronic
1034679805 7:152920026-152920048 GAGGAGGGAGGCAGATGAAGGGG - Intergenic
1035280662 7:157776225-157776247 GAGGAGGGAGGAAGATGAGAAGG - Intronic
1035280707 7:157776407-157776429 GAGGAGGGAGGAAGAGGAGGAGG - Intronic
1035915402 8:3615370-3615392 GAGGAGGGGAGTAGAGGAAGTGG - Intronic
1036154016 8:6325331-6325353 GAGGATGGAGGATGGTGAAGAGG - Intergenic
1036290314 8:7482221-7482243 GAGGTGGAAAGAAGATGAATAGG - Intergenic
1036331171 8:7829314-7829336 GAGGTGGAAAGAAGATGAATAGG + Intergenic
1036962575 8:13261359-13261381 AAGGATAGAAGAAGGTGAAGTGG + Intronic
1036993683 8:13629973-13629995 GGTGAGGGAAGAAGTGGAATTGG + Intergenic
1037331378 8:17747177-17747199 CAGTAGGGAATAAGGTGAAGAGG - Intronic
1037548277 8:19944970-19944992 AAGGAAGGAAGAAGGGGAAGGGG - Intronic
1037752833 8:21693748-21693770 GAGGAGAGAAGAAGAAGGAGAGG + Intronic
1037905323 8:22712989-22713011 GAGGTAGGAAGAAGTGGGAGAGG - Intergenic
1038070242 8:24005693-24005715 GAGGAGGGATGTAGTGGAACAGG + Intergenic
1038114954 8:24543466-24543488 GAAGAGGGCAGTAGTAGAAGAGG - Intergenic
1038281382 8:26168402-26168424 GAGGCCAGAAGAAGTAGAAGAGG - Intergenic
1038373521 8:27015242-27015264 GAGGGGAGGAGAAGTAGAAGAGG + Intergenic
1038414349 8:27383221-27383243 GGGGTGGGAAGAATTAGAAGAGG - Intronic
1038609736 8:29049320-29049342 GAGGAGGGAAGAAGTTCAGAGGG + Intronic
1038829512 8:31041666-31041688 GAGGAGATATGAAGTTTAAGTGG + Intronic
1039241318 8:35559729-35559751 GAGGAGGGAAGAAATGGAGAAGG - Intronic
1039469298 8:37803560-37803582 GAGGAGGGAGGAAGGGGAGGAGG - Intronic
1039557092 8:38484400-38484422 CAGGAGGGGAGAAGTGGCAGAGG - Intergenic
1039827014 8:41183208-41183230 GAGGAGGGAGGAAGTTGTGGAGG - Intergenic
1039998734 8:42558897-42558919 GAGGAGAGCAGAATTGGAAGTGG - Intergenic
1040355748 8:46617042-46617064 GAGGAGGGAGGCAGTTTAAGGGG + Intergenic
1040585578 8:48737381-48737403 GAGGATAAAAGAAGTGGAAGAGG - Intergenic
1040750600 8:50701657-50701679 GAAGAAGGAAGAAGAAGAAGAGG - Intronic
1041355056 8:56991914-56991936 GAGTAGGGAAGAAGAAAAAGTGG + Intronic
1041546618 8:59051786-59051808 GATGATGGAAAAAGTTGAATTGG + Intronic
1041568007 8:59302735-59302757 GAAGAGGGAGGAAGATGGAGAGG + Intergenic
1042346429 8:67732660-67732682 GAGGAGGTAAGAGTTTGAACTGG + Intronic
1042559314 8:70061102-70061124 GAGGAGGAGAGAAGTTAGAGAGG + Intronic
1042823057 8:72952755-72952777 GCTGAGGGAAGAGGGTGAAGAGG - Intergenic
1042882670 8:73511313-73511335 AAGGAGGGAAGAAGAAGATGAGG - Intronic
1044115286 8:88327644-88327666 GAGGAGGGAAGGAGAAGCAGAGG - Intronic
1044654600 8:94534591-94534613 GAGGAGGCAAGAGGGAGAAGGGG - Intronic
1044803184 8:95977980-95978002 GAGGAGGGAAAAAGAGGAAGAGG + Intergenic
1044925943 8:97208884-97208906 GAGGTGGGAAGAAGACAAAGGGG - Intergenic
1044935006 8:97285573-97285595 GAGGTGGGGAGGACTTGAAGTGG - Intergenic
1045203612 8:100013326-100013348 AAGTAGGAAAGAAGTTGAAATGG + Intronic
1045343030 8:101271099-101271121 GAGCAGGGAGGCAGTTGAAAGGG + Intergenic
1045451458 8:102330944-102330966 GGGGAAGGAAGAATTAGAAGAGG - Intronic
1045478018 8:102569549-102569571 GAGCAGAGGAGAACTTGAAGTGG + Intergenic
1045655071 8:104377995-104378017 GAGGAGGGAGGCAATGGAAGGGG + Intronic
1045752692 8:105504297-105504319 GAGCAGAGGAGAAGTGGAAGAGG + Intronic
1046595356 8:116255094-116255116 AATTATGGAAGAAGTTGAAGGGG - Intergenic
1046845329 8:118908945-118908967 GAGAAGGGAAGAAGTTTGGGGGG + Intergenic
1047194179 8:122706439-122706461 GATGATGGAAGAAGGTGAAGAGG + Intergenic
1047549050 8:125850037-125850059 AAGGAGGGAGGAAGTGGGAGAGG - Intergenic
1047957434 8:129986232-129986254 GAGAGGGGAAGCAGGTGAAGTGG + Intronic
1048116342 8:131527779-131527801 GTTGATGAAAGAAGTTGAAGAGG + Intergenic
1048559781 8:135521596-135521618 GAAGTGGAAAGAAGTTGAAGAGG - Intronic
1048754821 8:137727214-137727236 GAGGAGAGGAGAAGGGGAAGGGG + Intergenic
1049386062 8:142343759-142343781 GAGGAGGGGAGAAGAGGAGGAGG + Intronic
1049831600 8:144704597-144704619 GAGGAGGGGAGCAGGTGGAGGGG + Intergenic
1049854898 8:144855263-144855285 GAGGAGGGCAGTAGGAGAAGTGG + Intergenic
1050490860 9:6186552-6186574 GAGGGAGGGAGAAGGTGAAGGGG + Intergenic
1050690430 9:8221413-8221435 GAGTTGGGAGGAAGTAGAAGAGG - Intergenic
1050739074 9:8799639-8799661 AAGGAAGGCAGAAGTTGAAAGGG - Intronic
1051008285 9:12377084-12377106 GAGGAAGGATCAAGTGGAAGAGG - Intergenic
1051355966 9:16239981-16240003 GAGGAGGGAGGATGATGAACAGG - Intronic
1051516718 9:17937937-17937959 GAGGAGGGGGGAAGGTGATGTGG + Intergenic
1051684792 9:19646809-19646831 GATGAGGGAAGGAATTGCAGTGG - Intronic
1051740309 9:20245187-20245209 GAGGAGAGAAGAAGGTGGAGAGG + Intergenic
1051949723 9:22616852-22616874 GAAGAGGGAAGAAGAAGAGGGGG + Intergenic
1052868983 9:33484780-33484802 GCTGATGAAAGAAGTTGAAGAGG + Intergenic
1053061719 9:35036939-35036961 GAGGGGAAAAGAAGTTGAGGAGG + Intergenic
1055766060 9:79664706-79664728 AGGGAGGGAAGAAGTGGCAGCGG - Intronic
1055929181 9:81541918-81541940 GAGGAGGGAAGAAAATGAAGAGG + Intergenic
1055933639 9:81585055-81585077 GAAGAGGGAAGAAGTTCATGTGG - Intronic
1056206464 9:84323987-84324009 GAGGAAGAAAGAAGTAGGAGAGG - Intronic
1056300371 9:85233793-85233815 GAGGAGAGAGGAAGCTGAAATGG - Intergenic
1056381717 9:86062486-86062508 GAGGAGGGAGGAAGAGGAGGAGG + Intronic
1056431084 9:86528645-86528667 GAGGAGGGAAGTGCTTGAATAGG + Intergenic
1056701498 9:88914915-88914937 GCAGAGGGCAGAAGTTGAGGAGG - Intergenic
1056741352 9:89258016-89258038 GAGGATGGAAGAAGGAGCAGGGG + Intergenic
1057592077 9:96381414-96381436 GAGGAGTGAAGAGTTTGAATGGG - Intronic
1057744779 9:97742098-97742120 GAAGAAGGAAGAAGAGGAAGAGG + Intergenic
1057811042 9:98256708-98256730 GGGAAGGGGAGAAGTTTAAGGGG - Intergenic
1058120767 9:101136128-101136150 AAGGAGGGAAGAAGAGGAGGAGG - Intronic
1058431243 9:104921996-104922018 GAGGAGGGAAGCATTTAAATCGG + Intronic
1058643017 9:107105435-107105457 GTGGATGGAAGAATTTAAAGAGG - Intergenic
1058732254 9:107861715-107861737 GAGTAAGGAAAATGTTGAAGGGG + Intergenic
1058895246 9:109395161-109395183 GTGGAGGGAAGAAACTGAAGGGG + Intronic
1058928343 9:109691019-109691041 CAGAAGGGGGGAAGTTGAAGGGG + Intronic
1059072426 9:111152827-111152849 GAGGAGGGAGGAGGAGGAAGAGG + Intergenic
1059129796 9:111734961-111734983 GAGGAGGGAAGTGGGGGAAGGGG - Intronic
1059717763 9:116929770-116929792 TAAGAGGGAAGAAATAGAAGGGG - Intronic
1059942971 9:119375978-119376000 TAGGAGGGAATGAGTTGAAGTGG - Intergenic
1060383111 9:123195676-123195698 GCTGATGGAAGAAATTGAAGAGG + Intronic
1060701583 9:125756060-125756082 AAGGAAGGAAGAAGTTGAATTGG + Intronic
1060967672 9:127720876-127720898 GAGGAGGGAGGAAGGGGAAGGGG - Intronic
1061242853 9:129384284-129384306 GAGGAGGGGAGAAGCTGCGGAGG - Intergenic
1061574941 9:131500491-131500513 GAGGAGGTAAGCATTTGATGTGG + Intergenic
1061887191 9:133597484-133597506 GAGGTGTGGAGAAGTTCAAGGGG + Intergenic
1061957045 9:133969218-133969240 CAGGAGGGAAGCAGGTGCAGAGG - Intronic
1062151962 9:135024249-135024271 GGGGAGAGAGGAAGCTGAAGAGG + Intergenic
1062225326 9:135446836-135446858 GAGGGGGGAAACAGGTGAAGAGG + Intergenic
1062225434 9:135447117-135447139 GAGGGGGGAAACAGGTGAAGAGG + Intergenic
1062362605 9:136194749-136194771 GGGGAGGGAAGAGGGGGAAGAGG - Intergenic
1062362612 9:136194768-136194790 GAGGAGGGAAGAAGGGGAAGGGG - Intergenic
1062362632 9:136194820-136194842 GGGGAGGGAAGATGGAGAAGGGG - Intergenic
1062571563 9:137188161-137188183 GGGAAGGGAAGAAGCTGAGGGGG + Intronic
1062638432 9:137503663-137503685 GGGGAAGGAAGAAGGAGAAGGGG + Intronic
1203743332 Un_GL000218v1:21010-21032 GAGGAGGGGGGCACTTGAAGGGG - Intergenic
1203703610 Un_KI270742v1:15978-16000 GAGGAGGGGGGCACTTGAAGGGG - Intergenic
1203566776 Un_KI270744v1:98502-98524 GAGGAGGGTGGCACTTGAAGGGG + Intergenic
1185513958 X:684520-684542 GGGGAGGGAAGTCTTTGAAGAGG + Intergenic
1185662078 X:1735748-1735770 GAGGAGGGAGGAGGAGGAAGAGG - Intergenic
1185714583 X:2330716-2330738 GGGGAAGGAAGAAGTAGGAGGGG + Intronic
1185726688 X:2427286-2427308 GAGGAGGGAAGAAGGAGTAGGGG + Intronic
1186072064 X:5832896-5832918 GAGAAAGGAAGAAGAGGAAGAGG - Intergenic
1186217119 X:7312161-7312183 GAGGTGGGAACAAGATGAAGGGG - Intronic
1186482239 X:9904753-9904775 GAGGCTGGAAGAAGCTAAAGGGG - Intronic
1186707229 X:12154482-12154504 GAGGAGAGACGAAATAGAAGGGG + Intronic
1186932124 X:14405368-14405390 TAGGAGGGAAGAGAGTGAAGAGG + Intergenic
1186961782 X:14744567-14744589 TAGGAGGGAAGGAGGTGAAAAGG + Intergenic
1187309057 X:18123105-18123127 GAAGGGGAAAGAAGATGAAGGGG - Intergenic
1187541128 X:20196514-20196536 GAGGAGGGAGAAAGTTGAGTTGG + Intronic
1187822844 X:23306886-23306908 GAGGAGGGAAAAATTTATAGGGG - Intergenic
1187941291 X:24384946-24384968 TAGGGGGGATGGAGTTGAAGTGG - Intergenic
1188151431 X:26681089-26681111 AAGCAGGGCAGAAGGTGAAGGGG + Intergenic
1188385363 X:29550950-29550972 GAAGTGGGAAGACGTTGAATGGG - Intronic
1188735571 X:33710412-33710434 GAAGAGGAAAGAAGTAGGAGTGG + Intergenic
1188988842 X:36792375-36792397 GAGATGGGTAGAAGTTCAAGTGG - Intergenic
1189235671 X:39485052-39485074 GAGGAGGGAAGAAAATGAAAGGG - Intergenic
1189477020 X:41364038-41364060 TAGGAAGGAAGGAGTGGAAGGGG - Intronic
1190123398 X:47682631-47682653 GAGGAAGGAGGAGGATGAAGAGG - Intergenic
1190326175 X:49208425-49208447 CAGGAGGCAGGAAGTTGAGGGGG - Intronic
1190886463 X:54534780-54534802 GGGGAGGGAAAAAGGAGAAGGGG - Intronic
1190891337 X:54571849-54571871 AAGGAGGAAAGCAGGTGAAGAGG - Intergenic
1190988636 X:55522853-55522875 GAGGTGGGAAGTACTGGAAGTGG - Intergenic
1191110049 X:56797173-56797195 AAGGAGAGAAGAAGAGGAAGAGG - Intergenic
1191849435 X:65575088-65575110 GAGGGAGGAAGAAGGTGAGGGGG + Intergenic
1192433778 X:71129742-71129764 GAGGAGGGAGGAGGTGGCAGTGG + Exonic
1192557065 X:72098598-72098620 AAAGAGAGAAGAAGTTGAAAGGG + Intergenic
1192724194 X:73730335-73730357 TAGGAGGGGAGAAGTAGAAAGGG - Intergenic
1192733728 X:73828020-73828042 GAGGAAGTAAGTAGTAGAAGAGG + Intergenic
1194312588 X:92331318-92331340 AAGGAAGGAAGAAGAAGAAGAGG - Intronic
1194667099 X:96687197-96687219 GAGTAGGGAAGAAGGGGAAATGG + Intronic
1194806917 X:98340822-98340844 GATGAAAGAAGAAATTGAAGAGG - Intergenic
1195171670 X:102274535-102274557 GAAGAAGGAAGAAGAGGAAGAGG - Intergenic
1195187190 X:102412561-102412583 GAAGAAGGAAGAAGAGGAAGAGG + Intronic
1195227697 X:102815306-102815328 GAGCAGAGGACAAGTTGAAGTGG + Intergenic
1195561037 X:106284248-106284270 GATTAGGGAAGAAGTAAAAGGGG + Intergenic
1195942181 X:110175661-110175683 GAGGAAGGAAGAAGTAAAGGGGG + Exonic
1196277866 X:113789717-113789739 AAGGAGGGCAGAAGTTCAGGGGG + Intergenic
1196331778 X:114479396-114479418 GAGGAAGGAAGAAGGAAAAGAGG + Intergenic
1196789630 X:119452178-119452200 GAAGAGGGTAGAATTGGAAGAGG - Intronic
1197441525 X:126496429-126496451 GAGGAAGGGAGAAGCAGAAGAGG - Intergenic
1197562512 X:128040994-128041016 GAGGAGGGGAGAAAGTGAGGGGG - Intergenic
1197727841 X:129788130-129788152 TGGGAGGGAAGAGGGTGAAGAGG + Intronic
1198311821 X:135432524-135432546 GAGGAGGGAAGCAGAGGCAGGGG - Intergenic
1198631957 X:138649542-138649564 GAGGAGGGAAGAATCAGATGTGG - Intronic
1198809883 X:140524564-140524586 GAGAAGGGAAGAAATGGGAGAGG + Intergenic
1199312168 X:146333185-146333207 GAGGAGGAAAGTCTTTGAAGAGG + Intergenic
1199568505 X:149244131-149244153 GTGGATGCAAGAAATTGAAGAGG - Intergenic
1200059516 X:153478023-153478045 GAGAAGGGAAGCAGTGGAGGAGG - Intronic
1200154964 X:153970438-153970460 GAGGAGGGGAGAAGGGGGAGGGG + Intronic
1200255689 X:154581414-154581436 GAGGTTGCAAGAAGGTGAAGGGG - Intergenic
1200262080 X:154622990-154623012 GAGGTTGCAAGAAGGTGAAGGGG + Intergenic
1201156861 Y:11138481-11138503 GAGGAGGGGGGCACTTGAAGGGG - Intergenic
1201300184 Y:12498516-12498538 GAGGAAGGAGGAAGTGGAAGAGG - Intergenic