ID: 986832438

View in Genome Browser
Species Human (GRCh38)
Location 5:11595192-11595214
Sequence ATGGGAAAACAGGATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 729
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 664}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986832428_986832438 27 Left 986832428 5:11595142-11595164 CCAGCAGTTATCGCTGCTGAAAT 0: 1
1: 0
2: 0
3: 6
4: 98
Right 986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG 0: 1
1: 0
2: 4
3: 60
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986832438 Original CRISPR ATGGGAAAACAGGATGAGGA AGG Intronic
901277557 1:8004495-8004517 AGGAGAAAGCAGGATGACGATGG - Intronic
901451089 1:9337499-9337521 ATGGGAGAACAGGGTGAGGCTGG + Intronic
901839947 1:11947928-11947950 ATGGGAATGGAGGATGAGGGAGG - Intronic
902159142 1:14515546-14515568 ATGGTAGAACAGGAGAAGGATGG - Intergenic
902421665 1:16285560-16285582 ATGGGAAGACAGGATGGGCATGG - Intronic
902468741 1:16633353-16633375 AAGAGAACACAGGATGGGGATGG + Intergenic
902797966 1:18811664-18811686 ATGGGATGACAGGAGGAGAAGGG - Intergenic
903325563 1:22566877-22566899 ATGGGGACAGAGGAAGAGGAGGG + Intronic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
903959747 1:27049376-27049398 CTGGGAAAAACGGATCAGGATGG + Intergenic
904235490 1:29113982-29114004 TTGGGCAAACAGGATCAGGGAGG + Intronic
904357158 1:29947779-29947801 ATGAGAAAAGGGGAAGAGGAAGG - Intergenic
904371502 1:30050336-30050358 AGGGGCAGAGAGGATGAGGAAGG + Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
904473907 1:30752270-30752292 ATGGGAAAACAGGTCCAGCAGGG - Intronic
904621915 1:31780981-31781003 AGGGGACAACAGGGAGAGGATGG + Intergenic
905423490 1:37864237-37864259 ATGAGAAATGAGGTTGAGGAGGG - Intronic
906729949 1:48072310-48072332 AGGGGAATAAAGGATGAGGTGGG - Intergenic
907009203 1:50947195-50947217 AGGGAAAAAGAGGATGGGGAGGG + Intronic
907647788 1:56261526-56261548 ATGAGAAAACAGGATCAGAGTGG - Intergenic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
909093585 1:71258086-71258108 ATAGGAAAACAGGGAGAGGAGGG + Intergenic
909135359 1:71792421-71792443 TTGGTGAAACAGGATGAGAAGGG - Intronic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
909427088 1:75537685-75537707 TTGGGAATACAAGGTGAGGAGGG + Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
909704718 1:78568139-78568161 ATGTGAACACAGGGTGACGACGG + Intergenic
909970962 1:81989173-81989195 ATAGGAAAAGAGGTTTAGGAGGG - Intronic
909987173 1:82175227-82175249 ATGGGAAAATAGCAAGAAGATGG + Intergenic
910330082 1:86062684-86062706 ATGGGAGAAAAAGATGAGAAGGG - Intronic
911182660 1:94875123-94875145 ATCGCAAAAGAGAATGAGGAAGG + Intronic
913097446 1:115532583-115532605 ATGAGAAAACCTGAAGAGGAAGG + Intergenic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913181698 1:116328774-116328796 ATGGGGACAAAGGAAGAGGAAGG + Intergenic
914677925 1:149917937-149917959 AGGAGAAAAGAGGATGGGGAGGG + Intergenic
914845206 1:151280097-151280119 ATGAGAAAACAGGATCTGGGAGG + Exonic
915985450 1:160459715-160459737 ATGGGAAAACAGGCTTAGAGAGG + Intergenic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916607316 1:166355780-166355802 AAGGAAAAACATGATGAGAAGGG - Intergenic
916655124 1:166868514-166868536 GTGGGAGATCAGGATGAAGAAGG - Intronic
917158706 1:172032728-172032750 ATAAGAAAACAGGAAAAGGAAGG + Intronic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918648572 1:186930768-186930790 TTGGGAAAATAGGATTACGAAGG - Intronic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919463613 1:197907525-197907547 ATGAGAAAACAGTAGGAGAACGG - Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
919722199 1:200850057-200850079 GTGGGAAAACGGGTTTAGGAGGG - Exonic
920025041 1:202988142-202988164 AGGGGAAAACAGGAAGGGGGAGG - Intergenic
920219566 1:204386874-204386896 ATTGGAAAACAGGATGTGGATGG - Intergenic
920279124 1:204829686-204829708 TTGGGAAACTAGGATGGGGAAGG + Intronic
920689809 1:208137331-208137353 ATGGGAAAAGAGTATAGGGATGG - Intronic
920972210 1:210752645-210752667 TAGGGAACAGAGGATGAGGAGGG + Intronic
921969339 1:221129203-221129225 ATGGGAAGGAAGGAGGAGGAGGG + Intergenic
922360444 1:224816903-224816925 ATGGGAAGGCAAGATGTGGAAGG + Intergenic
922601242 1:226856127-226856149 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
923857939 1:237864790-237864812 ATTGGAGAACAGGAAGAGGTCGG - Intergenic
924648167 1:245899430-245899452 ATGGGAAAACAGGAGCGGGGAGG + Intronic
1062881433 10:981280-981302 AGAGGAAGACAGGATGATGAGGG - Intergenic
1063427088 10:5958954-5958976 AGGGGAGAACAGGAGGAAGAAGG - Intronic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064267543 10:13837098-13837120 ATGGGAACACATGGTGAGGATGG + Intronic
1064365372 10:14702884-14702906 ATGAGACAACAGGGAGAGGAAGG - Intronic
1064493435 10:15884145-15884167 GTGGGATACCAGGAAGAGGAAGG + Intergenic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1065519323 10:26556017-26556039 ATGAGAAAACAGGGTGAGAGAGG - Intronic
1066262823 10:33745620-33745642 ATGGGAGAGGAGGAGGAGGAGGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067548856 10:47219154-47219176 ATGGCCAGACAGGATCAGGATGG - Intergenic
1068326908 10:55502322-55502344 CTGGGCAAAGAGGATGAGAAGGG - Intronic
1068682818 10:59838499-59838521 GTGTGAAAATAGTATGAGGAAGG - Intronic
1069087931 10:64163406-64163428 ATGGGCAAACAGGATGTAAAAGG - Intergenic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1069842106 10:71346354-71346376 ATGGGAAAACAGGCTCATGGAGG + Intronic
1070476810 10:76836841-76836863 GAGGGCAAAGAGGATGAGGAAGG - Intergenic
1070630919 10:78084064-78084086 CTGGGGAACCAGGATGAGGGTGG + Intergenic
1071031191 10:81183290-81183312 AAAGGAATACAGGATGGGGAGGG + Intergenic
1071206530 10:83285914-83285936 ATGGGAAAAAAGGATAAAAAAGG + Intergenic
1072096730 10:92189015-92189037 AGGGGAAAAAAGGATTAGCATGG - Intronic
1072348553 10:94534274-94534296 ATGAGTAAAGAAGATGAGGATGG - Exonic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072743084 10:97922085-97922107 ATGGGAAACCGGGAGGAGGCTGG + Intronic
1073027057 10:100495749-100495771 GTGGAAAACCGGGATGAGGAAGG + Intronic
1073071249 10:100794569-100794591 ATGGGTAACCAGGATGGTGAGGG - Intronic
1073268023 10:102240213-102240235 ATGGGAAAACAGGAAGGAGCTGG - Intronic
1074087916 10:110222703-110222725 ATGGGGAAACAGGAAAAGCAAGG - Intronic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1075166335 10:120071288-120071310 ATGGGAACACAGCACCAGGAGGG + Intergenic
1075294377 10:121261545-121261567 AAGGGAAAATAGGATAAGTAGGG + Intergenic
1075645768 10:124094843-124094865 ATGGGAAACCGGGATGAGAGGGG + Intergenic
1075787883 10:125062162-125062184 AGGGGAAAACGGGGTGAGCAGGG + Intronic
1076150318 10:128157064-128157086 ATCGGAAAACAGGCTGAGCATGG - Intergenic
1076282911 10:129264864-129264886 AGGTGAAAACAGGATGATGGAGG + Intergenic
1076668351 10:132105338-132105360 ATGGGAATAAAGGAAAAGGATGG + Intronic
1077698613 11:4418697-4418719 ATATGAAAGCATGATGAGGAAGG - Intergenic
1077801608 11:5544666-5544688 ATTGGCAAACATGATGTGGAAGG + Exonic
1078373729 11:10774866-10774888 TTGGGAAAGAAGGAAGAGGAAGG + Intronic
1078425101 11:11243470-11243492 ATGTGGAAACAGCATGAGGCTGG + Intergenic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078609063 11:12803657-12803679 ATGGGAAGACAGGAGGCAGATGG + Intronic
1078727877 11:13948046-13948068 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1078841346 11:15078052-15078074 AGGGGAAAAAAAGAAGAGGAGGG - Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080015662 11:27504195-27504217 ATGGGAAATCAGAATGGTGAAGG - Intronic
1080119275 11:28657710-28657732 ATGGAAAAAGATGAAGAGGAGGG + Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1081328841 11:41779433-41779455 ATGGGAAAAGAGGGAGAGTATGG - Intergenic
1081533447 11:43981073-43981095 ATGGGGAAACAAGATGGGGCAGG + Intergenic
1081932554 11:46882155-46882177 ATGGGAATAAAGAAAGAGGAGGG + Intronic
1082858186 11:57828228-57828250 TAGGGAGAACAGGATGAGGCAGG - Intergenic
1082889032 11:58118791-58118813 ATAGGAAATCAGGATGACGGAGG + Exonic
1083511096 11:63209989-63210011 ATGGGAAAAAAGCAGGAGGAAGG + Intronic
1084457226 11:69274891-69274913 ATGGGAAAGCAGCATTAGGGAGG + Intergenic
1084548697 11:69827814-69827836 ACGGCAAAACATGATGATGACGG - Intergenic
1084903644 11:72329178-72329200 TTGGGAAAACAGAATTAGAATGG + Intronic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085115691 11:73929758-73929780 TTAAGAAAACAGGATGAGGCTGG + Intergenic
1085372437 11:76021314-76021336 ATAAGAAAACACCATGAGGAGGG - Intronic
1085508745 11:77074664-77074686 AGGGGAGAAGAGGTTGAGGAAGG + Intronic
1085965509 11:81518314-81518336 CTGGGAATACAGGAAAAGGAAGG + Intergenic
1086074244 11:82833362-82833384 ATGGAAAAAGAGGATGAGAAAGG + Intronic
1088435905 11:109812852-109812874 AGGGGAAAAAAGAGTGAGGAGGG - Intergenic
1088440051 11:109860242-109860264 ATGAGAAACAATGATGAGGAAGG + Intergenic
1088596900 11:111447901-111447923 ATGAGAAAACAAGATGAGGGTGG - Intronic
1088811731 11:113396892-113396914 ATGAGATCACAGGCTGAGGATGG + Intronic
1088986084 11:114909773-114909795 ATGGGATAACTGGATGAACAAGG - Intergenic
1089029633 11:115311676-115311698 ATGGGAAAACAGGCTGAGAGTGG + Intronic
1089362814 11:117902278-117902300 ATGGGAGAAGAGGGTGAGGGTGG + Intronic
1089854743 11:121533301-121533323 ATGAGAAAACAGGCTCAGCAAGG + Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090083940 11:123634252-123634274 GTGGGAACACAAGATGGGGAAGG + Intronic
1090183112 11:124718205-124718227 ACGGGAACAGAGGATGGGGACGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1091397103 12:160661-160683 ATTGGAAAACAGGTTGAAAACGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1092931479 12:13319912-13319934 ATGGAAAGAAAGGAGGAGGAAGG + Intergenic
1093235958 12:16608612-16608634 TTGGGGAAAAAGGAAGAGGATGG - Intronic
1093970990 12:25375923-25375945 TTAGGAAATCAGGAAGAGGATGG - Intergenic
1094039831 12:26111059-26111081 GGGGGAAAACAGGACAAGGAAGG + Intergenic
1094449039 12:30564565-30564587 ATGGGATGACTGGATGGGGAAGG + Intergenic
1096059570 12:48685314-48685336 ATGGGAAACTAGGAAGAGTATGG - Intergenic
1096081693 12:48837579-48837601 AATGGAAATGAGGATGAGGAAGG - Exonic
1096208281 12:49741756-49741778 TCGGGAAAACAGGGTGTGGAGGG + Intronic
1096332788 12:50729048-50729070 ATGGGATGACAGCATGTGGATGG + Intronic
1096613728 12:52819729-52819751 ATAAGAAAACAGGTTGAGGAAGG - Intergenic
1097242427 12:57584839-57584861 AGGGGAAAACAGGAAGAGGGAGG - Exonic
1097981780 12:65742645-65742667 AAGGGAAATCCGGATAAGGATGG + Intergenic
1098079180 12:66765859-66765881 ATGGGGAGACAGGAAGAAGATGG + Intronic
1098416558 12:70241931-70241953 AGGAGAAAGCAGGAAGAGGAAGG + Intergenic
1098476885 12:70915262-70915284 ATAGGATGATAGGATGAGGACGG + Intronic
1098528971 12:71519123-71519145 GTGGAATAACAGGAGGAGGATGG - Intronic
1099247324 12:80208692-80208714 ATGGAAAAACAGGGTGTGAAGGG + Intergenic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1100372472 12:93980865-93980887 AGGGGAAAAAGGGAGGAGGAAGG + Intergenic
1100803255 12:98255224-98255246 ATGGTAAAAATTGATGAGGAGGG - Intergenic
1101408901 12:104453248-104453270 AAGGGAAGACAAGATGAAGAGGG - Intergenic
1102039826 12:109793794-109793816 ATGGGAAAATAAAAGGAGGAAGG + Intronic
1102746865 12:115256610-115256632 ATGCAAAAACAGGTTGAGCAGGG + Intergenic
1102829577 12:115984747-115984769 ATGGGAAAATATTATGAGTAGGG - Intronic
1103245481 12:119453300-119453322 ATGGAAGAAAAGGAGGAGGAGGG - Intronic
1104045762 12:125161548-125161570 AAGGGAAATCAGGAGGAGAATGG - Intergenic
1106383197 13:29259905-29259927 ATGAGAACACAGGTTGAGGCAGG + Intronic
1107015790 13:35706810-35706832 ATGGGAGCAAAGGAAGAGGACGG + Intergenic
1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG + Intergenic
1108592445 13:51923659-51923681 ATGGAAAAAAAGGAAGATGAAGG + Intergenic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1108685084 13:52812626-52812648 ATGGGAAAATATGGTGAGGAGGG - Intergenic
1110040142 13:70744633-70744655 ATGAGAAAACAATGTGAGGATGG - Intergenic
1110228403 13:73143600-73143622 ATGGGTGAACAAGAGGAGGAAGG - Intergenic
1110237730 13:73233989-73234011 AAGGGAAAACATGATGAACAAGG - Intergenic
1112440597 13:99422079-99422101 GTGGGAAGACAGGCTGTGGAGGG - Intergenic
1112460845 13:99602550-99602572 ATGGGAAAGAAGGATGGGGCGGG - Intergenic
1113075831 13:106467127-106467149 ATAGGAAAACAGGAAAAGCAAGG + Intergenic
1113284302 13:108829627-108829649 ATGAGAAAAGACTATGAGGAGGG + Intronic
1113555795 13:111232973-111232995 CTGGGAGAACAGGGTGGGGATGG + Intronic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1114136013 14:19851903-19851925 ATGGGAAACCATGAGGAGAAAGG - Intergenic
1114219080 14:20681386-20681408 AAGGGAAAACCGGCAGAGGAAGG - Intergenic
1114527546 14:23376157-23376179 ATGGGAAAAGAGGAAGAGACAGG - Exonic
1114557145 14:23568515-23568537 ATGGGAAAACAACAGAAGGAGGG - Exonic
1115012355 14:28564691-28564713 ATTGGAAAACAGTATGTGGCTGG + Intergenic
1115320420 14:32075154-32075176 GTGGGAAAGAAGGATGCGGAAGG - Intergenic
1117088170 14:52222795-52222817 AAGGGAAAACTTGATAAGGAAGG - Intergenic
1117187453 14:53254978-53255000 ATGAGAAAATAGGGGGAGGAAGG + Intergenic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1117904139 14:60566701-60566723 CTGGGTTGACAGGATGAGGAAGG + Intergenic
1118533905 14:66737210-66737232 AAGGGAGAACAGGAAGAGGAAGG - Intronic
1118804434 14:69223169-69223191 ATGGGAATACAGGAAAAGAATGG - Intronic
1118979099 14:70701695-70701717 AGGGGAAAGGAGGAAGAGGAGGG + Intergenic
1119186176 14:72644042-72644064 ATGGAAAATGAGGATGATGATGG + Intronic
1119344341 14:73910121-73910143 CTTGGAAAACAAGATGGGGAAGG + Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119614138 14:76087309-76087331 ATTAGAAAACAGGATCAGAAAGG - Intergenic
1120356895 14:83445512-83445534 AGGGGAGAACACCATGAGGAAGG - Intergenic
1120856855 14:89220088-89220110 ATGAGAAGAAAGGAGGAGGAAGG - Intronic
1121654959 14:95588406-95588428 AGGGGAGACCAGGATGAGGAGGG + Intergenic
1122334550 14:100962039-100962061 ATGTGAAAAAAGGCTAAGGAAGG + Intergenic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124404752 15:29383067-29383089 TTGGGAAACCAGGAAGAGGTTGG - Intronic
1124550670 15:30678443-30678465 ATGGGATACCAGGCTGAGAATGG + Intronic
1124680579 15:31727168-31727190 ATGGGATACCAGGCTGAGAATGG - Intronic
1125426812 15:39556981-39557003 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126403315 15:48296647-48296669 ATGAGGAACAAGGATGAGGAAGG + Intronic
1127658622 15:61079110-61079132 TTGGGAAATTAGGAGGAGGATGG - Intronic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1128241781 15:66106179-66106201 ATGGGAAACAATGATGGGGAAGG + Intronic
1128296792 15:66527779-66527801 ATTTGAAAATAGGATTAGGATGG + Intronic
1128683669 15:69668563-69668585 AGGGGAAGAAAGGAGGAGGAGGG + Intergenic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1129258141 15:74345922-74345944 AAGGGAACAAAGGATGTGGAAGG - Intronic
1129338110 15:74866158-74866180 AAGTGAAAACAGGCTGAGGAAGG + Intronic
1129705378 15:77791230-77791252 GAGGGACAAGAGGATGAGGAGGG + Intronic
1129814221 15:78537950-78537972 AAGGGAAAACTTGATAAGGAAGG + Intergenic
1130182452 15:81644283-81644305 ATGGGAAAATCAGATGAGGAAGG + Intergenic
1130573705 15:85071789-85071811 GTGTGTAAACAGGATGAGAAGGG + Intronic
1130867874 15:87947701-87947723 AAGAGAAAACAGGGAGAGGAAGG + Intronic
1132006845 15:98235082-98235104 ATGGGAAAACTGAACCAGGAAGG - Intergenic
1132068961 15:98758605-98758627 CTGGGACAGCAGGATGAGCAGGG + Intronic
1133387640 16:5383195-5383217 GTGGGGAAACAGGAGGAGTAGGG + Intergenic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134631319 16:15758098-15758120 ATGGCAGAACAGGATGTGGGCGG - Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134892856 16:17856323-17856345 AGAGGAAAACAGGTTGAGAATGG - Intergenic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135002342 16:18787310-18787332 ATGGAAAAGAGGGATGAGGAAGG - Intronic
1135074763 16:19383639-19383661 ATGAGAAAACAGGCTCAGAAAGG - Intergenic
1135352521 16:21740992-21741014 ATGGGAAAACTGCTCGAGGAGGG - Intronic
1135451009 16:22557114-22557136 ATGGGAAAACTGCTCGAGGAGGG - Intergenic
1137404589 16:48179475-48179497 ATGGGCAAACAGGACGTGCAGGG + Intronic
1137579401 16:49624102-49624124 ATGGGAATATAGGATTTGGATGG - Intronic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138681083 16:58684190-58684212 ATAGGAAAACAGGCCCAGGAGGG + Exonic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1139405621 16:66715333-66715355 GGGGGAAGAAAGGATGAGGAAGG + Intergenic
1139629180 16:68217768-68217790 ATGGGAAAAAGGGAGGAAGAAGG + Intronic
1140025266 16:71283820-71283842 ATCGGAAAACTGGATTTGGAAGG + Exonic
1140465355 16:75176791-75176813 AAGGGAAAAGAGGAATAGGAAGG + Intergenic
1140659298 16:77172199-77172221 ATGAGAAAACAGGTTGGGGAAGG - Intergenic
1140756275 16:78070210-78070232 AAGGGAAAACTTGATAAGGAAGG - Intergenic
1141008003 16:80371327-80371349 ACGGGAAAACAGGACTGGGAAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141652432 16:85400226-85400248 ATGGGAAAACAGGAAGTGTAGGG + Intergenic
1141780679 16:86158439-86158461 CTGGGGACACAGCATGAGGATGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142288953 16:89183987-89184009 ATGTGAGTACAGGGTGAGGATGG - Intronic
1142352014 16:89584872-89584894 ATGGGAACACAGGGAGGGGAAGG + Intronic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1142930836 17:3282853-3282875 TGGGGAAAACAGCATGAGCAAGG - Intergenic
1143356999 17:6337753-6337775 ATGGGAAAGCAGGTTGGGCATGG + Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143669315 17:8385492-8385514 GTGGGAAGACAGGAAGACGATGG - Intergenic
1143840738 17:9729298-9729320 GTGGGCAAACAAGATGAGGCTGG + Exonic
1144111371 17:12037390-12037412 ATAGGAAAACAGGAAAAGCAAGG + Intronic
1144176887 17:12716231-12716253 ATGGGTAGAGAGGAAGAGGAGGG + Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1145051089 17:19661573-19661595 ATGGGAAAACAGCACAAAGAAGG + Intronic
1145257392 17:21334065-21334087 ATCGGACCACAGGCTGAGGAGGG + Intergenic
1145376705 17:22356389-22356411 ATGGGAAAAGAGATTAAGGAAGG - Intergenic
1146554033 17:33807659-33807681 ATGTGTGAAGAGGATGAGGAGGG - Intronic
1149008866 17:51834353-51834375 ATGGGAAAACAGGAAAAGAATGG + Intronic
1149364107 17:55923533-55923555 TTGGGAGAATGGGATGAGGATGG - Intergenic
1150427282 17:65086716-65086738 AAGGGAGAACAGGAAGGGGAAGG - Intergenic
1150936762 17:69644064-69644086 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1150939501 17:69675115-69675137 ATGGGAAAACAGGTACAGAAAGG + Intergenic
1150998662 17:70348791-70348813 ATGGAAAAGAGGGATGAGGAAGG - Intergenic
1151081151 17:71330349-71330371 CTAGGAAAAAAGTATGAGGAAGG + Intergenic
1151272323 17:73006462-73006484 AAGGGAGAAGAGGATGGGGAGGG + Intronic
1151524283 17:74653264-74653286 AAGGGAAGAGAGGAAGAGGAGGG + Intergenic
1152218381 17:79047580-79047602 ATGGCAAAACAGGCTCAGCAGGG + Exonic
1153492636 18:5665125-5665147 CTGGGAAAACAGGAAGATAATGG + Intergenic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155870149 18:31016890-31016912 ATGGGAAAATAAGATAGGGAAGG - Intronic
1156080577 18:33329822-33329844 AAAGGAAAAGAGGAAGAGGAAGG - Intronic
1156447512 18:37248551-37248573 GTGGGAAAAGAGGATGGGGTAGG - Intronic
1156651784 18:39234288-39234310 ATGGGAAAACTGGCTGGGCATGG - Intergenic
1156704154 18:39859600-39859622 CTGGGATGACAGGGTGAGGAAGG + Intergenic
1156992728 18:43429580-43429602 CTGGCAAAACAGGTTGATGAAGG + Intergenic
1157303667 18:46500101-46500123 ATGGAAAAGAAGGAAGAGGAGGG - Intronic
1157573464 18:48729060-48729082 AGGGGAGGACAGGATGAGGAGGG - Intronic
1157624954 18:49043560-49043582 ATGAGAAAAGATGATGAGGCAGG - Exonic
1157910589 18:51614287-51614309 ATGGGTCAACAGGAGTAGGAAGG - Intergenic
1158367696 18:56757172-56757194 ATGGGAAAACAGAAGTAGGAAGG + Exonic
1159018607 18:63123942-63123964 ATGGGAACACTGGTGGAGGATGG - Exonic
1160355178 18:78221639-78221661 ATGGCAAATCCAGATGAGGAAGG - Intergenic
1160676585 19:394414-394436 ATGGGGAAAGATGATGGGGAAGG + Intergenic
1160920783 19:1519382-1519404 ATGGGAAAACATCAGGAGCAGGG + Intergenic
1162584534 19:11551097-11551119 ATGGGAAAACAGGTCTAGGGAGG - Intergenic
1162846637 19:13397817-13397839 AAGGGAAAAGAGCATGAGAAGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164011184 19:21204711-21204733 ATGGGATAAAAGCAGGAGGAAGG - Intergenic
1164015836 19:21255250-21255272 ATGGGATAAAAGCAGGAGGAAGG + Intronic
1164565668 19:29324184-29324206 ATGGGAAAATAGGGTGAGCTGGG + Intergenic
1164953878 19:32363983-32364005 ATGGGAAAAGAGGCTTAGTATGG - Intronic
1165951631 19:39476806-39476828 ATGGGAAAACAGATTTAGGTAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166983386 19:46645218-46645240 ATAGAAAAACAGGACGAGCACGG + Intergenic
1167593439 19:50416159-50416181 AGGGGAAGCAAGGATGAGGAAGG - Intronic
1167607627 19:50489841-50489863 ATGGGAGAACAGAAAGAGGGAGG + Exonic
1167734383 19:51283094-51283116 ATTGGAAGAAAGTATGAGGAAGG - Intergenic
1167772717 19:51530971-51530993 ATGGGGACGCAGGATCAGGATGG + Intronic
1167850997 19:52201918-52201940 ATGAGAGAACAAGAAGAGGAGGG - Intronic
1168120455 19:54249579-54249601 TTGGGAGAATAGAATGAGGAGGG + Intronic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
1168397364 19:56059995-56060017 AGGTGAAGACAGGATGAGGAAGG + Intronic
1168482426 19:56732725-56732747 CTGGAAATACAGGATGAGGTTGG + Intergenic
1168659395 19:58154627-58154649 AAGGAAAAAAAGGACGAGGAAGG - Intronic
925413080 2:3651196-3651218 GTGGGAAAAGAGGACGAGGACGG + Intergenic
925496626 2:4457492-4457514 ATAGGAACTCAGGATGTGGAAGG - Intergenic
925539270 2:4949333-4949355 ATGGGAAGAGAGGATTATGAAGG - Intergenic
925713456 2:6763875-6763897 ATGAGAAAAAAGGAAGAGAAGGG + Intergenic
925732029 2:6926127-6926149 AAAGGAAAACATGCTGAGGATGG - Intronic
925810381 2:7694362-7694384 ATGAGAAAACAGGCCCAGGAAGG + Intergenic
926024110 2:9524783-9524805 TTGGGAAAACTGGAGAAGGAAGG + Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926376553 2:12234476-12234498 AGGGGAAAACAAGATGAAGAAGG + Intergenic
927416263 2:22883817-22883839 ATGGAAAAAAGGGAAGAGGAGGG + Intergenic
927800383 2:26093689-26093711 ATGAGAAAACATGATGATCAGGG + Intronic
927829831 2:26339920-26339942 ACGGGAAAACTTGATAAGGAAGG - Intronic
928459326 2:31456173-31456195 ATGGGAAAAAAGGATGTGTGAGG - Intergenic
928840305 2:35598278-35598300 ATGTGAAAAGAGTAAGAGGAAGG + Intergenic
928937348 2:36693275-36693297 ATGGGAAAATAGGATAGGAATGG - Intergenic
929359486 2:41068460-41068482 ATGGGATTACAGCATGAGGCAGG - Intergenic
929757292 2:44778416-44778438 AAGGGAAAACAGGAGTTGGAGGG + Intergenic
930358502 2:50348350-50348372 ATGGGAAGAGAGGAAGAGAAGGG + Intronic
930845653 2:55900712-55900734 ATGGGGAAACTGGATGTGGCTGG + Intronic
931025429 2:58108910-58108932 ATGAGAAAAAAGGATGAGTAAGG - Intronic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
931632747 2:64316028-64316050 CTGAGAAAACAGCATCAGGATGG - Intergenic
931766021 2:65457219-65457241 GTGGTAGAACAGGATGGGGAAGG - Intergenic
931786332 2:65622425-65622447 AGGGGAAAAGAGAATGAGGAGGG + Intergenic
933450441 2:82442712-82442734 ATTGGAAAAGTGGAGGAGGAGGG + Intergenic
934625627 2:95848142-95848164 AAGGAAAAACAGAATGAGAAGGG + Intronic
934807944 2:97253174-97253196 AAGGAAAAACAGAATGAGAAGGG - Intronic
934829566 2:97504013-97504035 AAGGAAAAACAGAATGAGAAGGG + Intronic
935162206 2:100538866-100538888 AAGGGAAAACAGGGTGGGGTTGG - Intergenic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
936917761 2:117657279-117657301 CTGGGTAAACAGGAAGAAGAGGG - Intergenic
937127644 2:119484449-119484471 ATGGGATACCAGGTTGAGGGAGG + Intronic
937833247 2:126445951-126445973 ATGGGAACAGAGGAAGAGAAAGG + Intergenic
937834753 2:126460952-126460974 ATGGGAGAACAGGAGTGGGAGGG - Intergenic
938371070 2:130768612-130768634 AGGGAAAAACAGGCTGAGGGTGG - Intergenic
938378793 2:130825310-130825332 ATGGGCAGACAGCATGAGGGAGG - Intergenic
939005592 2:136783191-136783213 CTGAGAAAACAAGATGAGAATGG - Intronic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
939767355 2:146267376-146267398 TGGTGAAAGCAGGATGAGGAAGG + Intergenic
940159280 2:150693855-150693877 AGAGGAAAGCAGGATGGGGAAGG + Intergenic
940492799 2:154386287-154386309 GTGGGAAAACAGAATAAGGGAGG + Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941338331 2:164272703-164272725 ATGGAAAAAAAAGAAGAGGAGGG - Intergenic
941848837 2:170158931-170158953 ATGAGAAAACTGGCTTAGGAAGG - Intergenic
942247776 2:174023732-174023754 ATAGGAAGACAGGAGAAGGAGGG + Intergenic
942894749 2:181038910-181038932 ATAAAAAAACAGGATGAGGAAGG + Intronic
942895763 2:181052337-181052359 AGAGAAAAAGAGGATGAGGAAGG - Intronic
944371473 2:198988459-198988481 ATGAGACAACATGATGAGTATGG - Intergenic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
944667494 2:201969622-201969644 ATGGCAGAGAAGGATGAGGAAGG - Intergenic
945781914 2:214185901-214185923 ATAGAAAAACAAGATGAGTATGG - Intronic
945972248 2:216242392-216242414 CTGGGAAAACACGGTGCGGAGGG - Intergenic
946978390 2:225178421-225178443 AAGGGAAAAGGGGATGAGGGTGG - Intergenic
947008151 2:225536233-225536255 TTGGGAGAACAGGAGGAAGAAGG - Intronic
947592671 2:231394455-231394477 AAAGGAAAAAAGGTTGAGGAAGG + Intergenic
947795482 2:232891388-232891410 CTGGAAAGGCAGGATGAGGAAGG + Exonic
948088147 2:235267653-235267675 ATGGGAGAACAGGTCAAGGAGGG - Intergenic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1170235724 20:14102783-14102805 ATGGGGATATAGGATGGGGATGG + Intronic
1170323787 20:15133232-15133254 AGGAGAAAACAGTATGAGAAAGG + Intronic
1170910292 20:20559711-20559733 ATGAGGAAATAGGAGGAGGAGGG + Intronic
1171301381 20:24063959-24063981 TTGGGGAAACAGGAAGGGGAGGG - Intergenic
1171373037 20:24673965-24673987 TTGGGAAACAAAGATGAGGAAGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172038498 20:32027295-32027317 AAGGGCATACAGTATGAGGAAGG - Intronic
1172266744 20:33622174-33622196 TTTGGAAAACAGCATGAGGTAGG + Intronic
1172564000 20:35914010-35914032 CTGGAAGAACAGGATCAGGAAGG - Intronic
1173201532 20:40958786-40958808 GTGGGAAAGCGGGATGGGGAGGG - Intergenic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173633598 20:44535207-44535229 ATGGGATGACAGGATGAGTAAGG + Intronic
1173735166 20:45355770-45355792 ATGAGAAAACAGGCGGAGCAAGG + Intergenic
1174867607 20:54152409-54152431 TGGGGACAGCAGGATGAGGAAGG - Intergenic
1174924726 20:54746594-54746616 TTGGGGAAACAGGATGATTATGG - Intergenic
1175134794 20:56815145-56815167 ATTGGAAGAGAGGAGGAGGAGGG + Intergenic
1175532757 20:59685298-59685320 AATGGAAGACAAGATGAGGAAGG - Intronic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176031123 20:63012568-63012590 AAGGAAAAACAGGATGGGCATGG - Intergenic
1176380254 21:6109037-6109059 AAGGGAAAACAGGATGGCCATGG + Intergenic
1177151917 21:17463787-17463809 ATGGGAAAACAAGAAGATTAAGG + Intergenic
1177198176 21:17924545-17924567 ATGGGCAAATAGGATGAAGCTGG - Intronic
1177467341 21:21503608-21503630 AATGCAAAACTGGATGAGGAGGG + Intronic
1177604823 21:23364198-23364220 AGGGAAAAACAGGAGGAGCAGGG + Intergenic
1178079428 21:29047790-29047812 TTGGGTAAATAGGATGTGGAGGG + Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178462366 21:32814589-32814611 ATGGGAAAAAAAGATAAGGCAGG + Intergenic
1179594289 21:42431553-42431575 ATGGGAAAACAGCAAGGGGATGG + Intronic
1179743220 21:43429201-43429223 AAGGGAAAACAGGATGGCCATGG - Intergenic
1180174511 21:46081151-46081173 CGGGGACAACGGGATGAGGAGGG + Intergenic
1181363214 22:22354628-22354650 ATGGGGAGACAGGATGAGTGGGG - Intergenic
1181366037 22:22377732-22377754 ATGGGGAGACAGGATGAGTGGGG - Intergenic
1181372459 22:22429194-22429216 ATGGGGAGACAGGATGAGTGGGG - Intergenic
1181539634 22:23566398-23566420 ACGGGAGAACGGGAGGAGGAGGG + Intergenic
1182519783 22:30878809-30878831 ATGGGAAAACCTGGGGAGGAAGG + Intronic
1183328157 22:37205465-37205487 AAGGGAGAAGAGGAAGAGGAAGG - Exonic
1184544103 22:45154085-45154107 ATGGGAAGACAGCAAGAGAATGG - Intergenic
1184895005 22:47401587-47401609 AAGGCACAACAGGATGAAGAAGG + Intergenic
1185101769 22:48844491-48844513 ATAGGAAGACGGGATGGGGAAGG - Intronic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949229375 3:1732439-1732461 AAGGGAAAACAGGAAGATGGAGG - Intergenic
949433326 3:4002095-4002117 CTGGGAAAACTGCATGAGGGTGG + Intronic
950208213 3:11096391-11096413 GTGGGAAAGCAGGATATGGAAGG - Intergenic
950298393 3:11851912-11851934 CTGGGACTAAAGGATGAGGAAGG - Intergenic
950322825 3:12072712-12072734 ATAGAAAAACAGGATGAATATGG - Intronic
950400757 3:12767707-12767729 ACGGGAAAACAGGATGACTAGGG + Intronic
952221496 3:31328111-31328133 CTCGGAAAACAGGAAGATGAGGG - Intergenic
952597466 3:35035458-35035480 AGGGGAAAACAGCAAGGGGAAGG + Intergenic
953158438 3:40395901-40395923 ATGAGAAAACAGGAAAAGAAAGG + Intronic
953545542 3:43861520-43861542 CTGGGAACACAGTAAGAGGAAGG + Intergenic
953706125 3:45231875-45231897 ATGAGAAAACAGGTGCAGGAAGG + Intergenic
954216665 3:49128586-49128608 CTGGGAAAACGGGATGATGGAGG + Intronic
954613564 3:51958481-51958503 ATGGGAAAGGTGGAAGAGGAAGG + Intronic
954656139 3:52195350-52195372 AAGGGAAAAGAAGATGGGGAAGG + Intergenic
954727202 3:52622725-52622747 AAAGGAAAACAGGATGTAGAAGG - Intronic
955102382 3:55863009-55863031 ATGGGAAAATGGGAAGTGGAGGG - Intronic
955311168 3:57888091-57888113 ATAAGAAAACAGAAAGAGGAAGG + Intronic
955618644 3:60836801-60836823 AAGGGAAAACTTGATAAGGAAGG + Intronic
955644779 3:61125780-61125802 ATGGGGAAACAGGAAAAGGATGG + Intronic
955751154 3:62186460-62186482 ATGGGCACACAGGGTGAGGAGGG + Intronic
955930865 3:64055531-64055553 AGGGAAAAACAGGATGAATAGGG - Intergenic
955946918 3:64204235-64204257 ATGGGAGGTCAGGATGGGGAGGG + Intronic
956140241 3:66139042-66139064 AGAGGAAAAGAGGATGGGGAGGG - Intronic
956208570 3:66779341-66779363 ATGGGAAAAAATGATGGGAAAGG + Intergenic
957610383 3:82458461-82458483 TTAGGAAAACAGCATGAGGATGG - Intergenic
957878209 3:86176369-86176391 CTGTGAGAACATGATGAGGAAGG + Intergenic
958883483 3:99699416-99699438 ATGTGAGAGCAGGAAGAGGAAGG - Intronic
958953629 3:100442938-100442960 AAGAGAAAATAGGAGGAGGAAGG + Intronic
959366123 3:105459896-105459918 ATGGGACAGCAGGCTGTGGAAGG + Intronic
959494169 3:107030078-107030100 ATGATAAAACAAGATGATGAGGG - Intergenic
959542635 3:107557900-107557922 GGGGGAAAGCAGGATGAGGAGGG + Intronic
959805394 3:110546293-110546315 ATGGGAGGACATGGTGAGGAAGG - Intergenic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960189404 3:114685070-114685092 ATGGGAAAACAGAATGATGTAGG - Intronic
960418340 3:117412707-117412729 AGAGGAAAAGAGGATGAAGAAGG - Intergenic
960755529 3:121007628-121007650 AGGAGATAACAGGATGAGGGTGG + Intronic
961000492 3:123370910-123370932 AAGGGAAGGCAGGATGAGGCTGG + Intronic
961029507 3:123589575-123589597 ATGGGAAAGTAGGAGGAGGCAGG + Intergenic
961422541 3:126817751-126817773 AGGGGAAGACAGGCTGAGGCAGG - Intronic
961914334 3:130356038-130356060 ATGCAAAAAAAGGAAGAGGAGGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962347078 3:134626132-134626154 GTGGGAAGACAGGATGGGGGTGG + Intronic
962611102 3:137076889-137076911 ATGGGAGAAAAAAATGAGGAGGG + Intergenic
962694750 3:137937016-137937038 AGGGGAAAAGAGGATGAGGCAGG + Intergenic
963082436 3:141406662-141406684 AGGGGAAAAATGGTTGAGGATGG + Intronic
963656401 3:148056934-148056956 ATGGGATAGCAGCAAGAGGAGGG - Intergenic
963773889 3:149418974-149418996 ATGGGAAAGAAGGATGACAAAGG + Intergenic
964478913 3:157122744-157122766 ATGAGAAAACAGGCTCAGAAGGG + Intergenic
965516238 3:169624468-169624490 ATGGAAAGACAAGTTGAGGATGG + Intronic
965556674 3:170025640-170025662 ATGAGAACTGAGGATGAGGAAGG + Intergenic
965648091 3:170905800-170905822 ATGAGAAAACAGGCTCAGAAAGG + Intronic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
966493025 3:180550376-180550398 ATGGTAAAACAGGAAGACCAAGG - Intergenic
967224176 3:187275150-187275172 ACGGGAAAATAGCCTGAGGATGG + Intronic
967457774 3:189709390-189709412 ATAGGACAACAGAATGATGAAGG - Intronic
967582639 3:191178274-191178296 ATGGGAACACAGCATAAGGTGGG + Intergenic
968336138 3:197915350-197915372 AGGGGAGGACAGGATGAGGTTGG + Intronic
968347044 3:198017368-198017390 TTGGGAAACCAGGGTGAGAAGGG + Intronic
968936995 4:3616579-3616601 GTGGGAAGACAAGATGAGCAGGG - Intergenic
968949409 4:3682841-3682863 AGGGGATTACAGGATGAGGTGGG + Intergenic
969206160 4:5647841-5647863 ATAGGAAAACAGGCAGAAGAGGG + Intronic
969445482 4:7242631-7242653 TTGGGAAAGCAGGATGAATAGGG - Intronic
969561194 4:7949531-7949553 AAGGGGAAAGAGGAAGAGGAAGG - Intergenic
969727780 4:8934091-8934113 AAGAGAAAATAGGAGGAGGAAGG - Intergenic
969903241 4:10369442-10369464 ATGTGAAGATAGGAGGAGGAGGG + Intergenic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970491742 4:16582277-16582299 ATGGGCAAACAGGATCTGGTGGG + Intronic
970935727 4:21567747-21567769 AACTGAAAACTGGATGAGGATGG + Intronic
970947627 4:21713768-21713790 ATGGGAAAAAAGGCTGGAGAGGG - Intronic
971261090 4:25057537-25057559 GTGGGACAAGAGGGTGAGGAGGG + Intergenic
971408258 4:26342520-26342542 ATGGGAGAAAGGAATGAGGAGGG - Intronic
971430917 4:26566353-26566375 ATAAGAAAACAACATGAGGAAGG + Intergenic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
971801821 4:31303066-31303088 ATGAGAAAACAGGCTGGGCACGG + Intergenic
972022524 4:34334040-34334062 ACAGGAAGAAAGGATGAGGAGGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972332569 4:38077717-38077739 AGGGGAAAAAAGGATGACGACGG - Intronic
972430836 4:38980129-38980151 ATGTGAAAATAAAATGAGGATGG + Intronic
972930138 4:44062517-44062539 ATGGCAAAAAAGGAGGGGGAGGG - Intergenic
973245318 4:48004633-48004655 AAGAGAAAATAGGAGGAGGAAGG + Intronic
973330068 4:48904026-48904048 TAGGGAAAATAGGATGGGGAAGG - Intronic
975483344 4:74906465-74906487 AGGGGAGAAAAGGATGAGAAAGG + Intergenic
975691815 4:76972910-76972932 ATGAGAAAACAGGCTCAGAAAGG + Intronic
975923743 4:79424128-79424150 TTGGGAAAACAGGAACAGCAAGG + Intergenic
975941756 4:79656565-79656587 ATAGTAAAAAAGGATGAAGAAGG - Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976382318 4:84413666-84413688 CTGGGAAGACAGCATGAAGAGGG + Intergenic
976389020 4:84490764-84490786 AAAGGAAAAAAGGAAGAGGAAGG + Intergenic
976475512 4:85478019-85478041 TTGGAAAAACAAGATGGGGAAGG + Intronic
976672461 4:87668769-87668791 ATGGAAAAAGAGAAAGAGGAAGG + Intergenic
976822765 4:89225557-89225579 ATGGGAGAACAGAATTTGGAGGG + Intergenic
977548050 4:98408859-98408881 TTAGGAAAACAGGACTAGGAAGG + Intronic
977888664 4:102281330-102281352 ATGAGAAAACAGGGGTAGGATGG + Intronic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978227396 4:106353619-106353641 ATGGGAAAAGATGAAGAGGAAGG + Intergenic
978338259 4:107693216-107693238 CTGTGAAAACAGGAACAGGAGGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978545269 4:109865184-109865206 ATGAGAAAACAGGCTCAGCAAGG + Intronic
979011854 4:115380980-115381002 ATGGGAAAGCTGGCTGAGAAAGG - Intergenic
980018936 4:127684711-127684733 ATGAGAAAATAAGAAGAGGAAGG - Intronic
980873322 4:138635022-138635044 TTGGGAAAACTGGTAGAGGAAGG - Intergenic
981412555 4:144449970-144449992 ATGGAAGAACATGATGCGGAAGG + Intergenic
981491158 4:145340792-145340814 ATGTTAAATAAGGATGAGGATGG + Intergenic
982043682 4:151420426-151420448 ATGGGGAAAAAGGAAGAGGTAGG - Intronic
982140315 4:152311056-152311078 ATGGGAAAACAGGTTGGAGAGGG + Intergenic
982409957 4:155063712-155063734 ATTGGAAGAAAGCATGAGGAAGG - Intergenic
982828941 4:160036021-160036043 ATGGGATAACAGGCATAGGATGG + Intergenic
984937914 4:184905543-184905565 ATGTGGAATAAGGATGAGGATGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985187686 4:187335430-187335452 ATTTGAAAACAGGTTGAGGCAGG + Intergenic
986431528 5:7685668-7685690 TTGGGAGAACAGGGTGATGAAGG + Intronic
986511589 5:8512752-8512774 ATGGCAAAAGATGAAGAGGAAGG + Intergenic
986681829 5:10240541-10240563 ATGAGAAAACAGGCTCAGCAAGG - Intronic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987052696 5:14161340-14161362 AAGGGAAACCAGGAAGAAGAGGG - Intronic
987206415 5:15631558-15631580 ATGGGACAGGAGGCTGAGGAAGG + Intronic
987525514 5:19044941-19044963 ATGGGTAAACTGGGAGAGGAGGG + Intergenic
987689149 5:21244623-21244645 AGGGGAAGACAGGAAGATGAGGG + Intergenic
987748116 5:22004245-22004267 ACAGAAAAACAGCATGAGGAAGG - Intronic
988474517 5:31572084-31572106 ATGAGCAAACAGGAAGAAGAGGG + Intergenic
989193739 5:38695674-38695696 ATGGGGAAAGAGGAGGAAGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990011976 5:51010428-51010450 ATGGGAAAACATGTTGAGAAGGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990499908 5:56385752-56385774 ATGGGAGAGGAGGAAGAGGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990742643 5:58927918-58927940 ATGAGAAAACAAGAAGAGGGAGG - Intergenic
990820266 5:59831579-59831601 ATGGGAAAACAGGCTTAGTGAGG + Intronic
991603113 5:68373133-68373155 ATGGGAAAACTTGATAAGGAAGG + Intergenic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
992292939 5:75298992-75299014 AAGAGAAAATAGGGTGAGGAAGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992422641 5:76621972-76621994 ATGGAAAAGAGGGATGAGGAAGG - Intronic
993407439 5:87529113-87529135 ATGGAAAAAGAGCATGAGAATGG + Intergenic
994475928 5:100269572-100269594 ATGCCAAAACAGGATCATGAAGG + Intergenic
995321508 5:110839637-110839659 AAGGGAAAGAAGGAAGAGGAAGG - Intergenic
995653651 5:114400440-114400462 TGGGGAAAACAGGGTGAAGAGGG - Intronic
995906791 5:117134365-117134387 CTGGGGAAAAAGGATCAGGAGGG + Intergenic
995969408 5:117949745-117949767 ATGAGAAGAAAGGAAGAGGAAGG + Intergenic
996580760 5:125029626-125029648 ATGGGAAAAAGGGCAGAGGAGGG - Intergenic
998794640 5:145805196-145805218 ATGGAAATAAGGGATGAGGAGGG - Intronic
999090107 5:148928509-148928531 AGAGGAAAACAAGATGAGCAAGG - Intronic
999320981 5:150614923-150614945 ATGGCAAAGCAGGATGTGAATGG - Intronic
999744407 5:154580765-154580787 AAGGGGAAACAGGAATAGGACGG + Intergenic
999805480 5:155077225-155077247 ATGAGAAAACAGGCTCAGGGAGG + Intergenic
999965347 5:156803528-156803550 TTGGGAAACCAGAATGGGGAGGG + Intergenic
1000209826 5:159098755-159098777 AGGGGAAGAAAGGAAGAGGAAGG + Intronic
1000882672 5:166715838-166715860 ATTCGAAGACAGGAAGAGGAGGG - Intergenic
1001061348 5:168492144-168492166 ATGGGAAAACAGGAGGTAGTAGG + Intronic
1001317904 5:170657351-170657373 CTGGGAAATGAGGGTGAGGAGGG + Intronic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003681974 6:8265701-8265723 AAGGGAAAAAAGGATGGGAAGGG + Intergenic
1003858218 6:10297158-10297180 ATGAGATGACAGAATGAGGAGGG - Intergenic
1003959930 6:11199372-11199394 ATGAGAAAACAGGCTTAGAATGG - Intronic
1004735895 6:18406211-18406233 ATGGAAAAATAGGGTGAGGGGGG + Intronic
1005190541 6:23216777-23216799 ATGGGAAAATAGAATGAAAAAGG + Intergenic
1005828993 6:29655573-29655595 ATGGGAGATCAGGATGAGGGTGG - Intergenic
1005896649 6:30184911-30184933 ATGGGAAGACAGGGAAAGGAAGG - Exonic
1006079569 6:31557675-31557697 ATGGGAATAAAGAATAAGGATGG + Exonic
1006808386 6:36803950-36803972 ATGAGAATACAGCAGGAGGAAGG + Intronic
1007013244 6:38437862-38437884 ATGGGAAAACAAAATGAAAAGGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1010250065 6:73697841-73697863 ATGGGAGAAGGGGAAGAGGATGG + Intronic
1011552160 6:88539778-88539800 TTAGGAAAACAAGAGGAGGAAGG + Intergenic
1012031616 6:94074955-94074977 ATCAGAAAACAGGCTGAGAAAGG - Intergenic
1012347342 6:98207151-98207173 ATGAGAAAACAGGTTCAGAATGG + Intergenic
1013505234 6:110793664-110793686 AAGGGAAAACAGGTTGTGAATGG - Intronic
1014323144 6:119957296-119957318 GTGGGAAAAGAGGAACAGGAAGG + Intergenic
1014914966 6:127135559-127135581 ATTGGAGAAGAGGATAAGGAGGG + Intronic
1015533774 6:134246478-134246500 TTGGGAAAAAAGGGTGAAGATGG + Intronic
1015898992 6:138045613-138045635 GAGGGAAAGGAGGATGAGGATGG - Intergenic
1016034762 6:139374281-139374303 GTGCAACAACAGGATGAGGAGGG - Intronic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016587152 6:145702039-145702061 ATTGGAAACCTGGAAGAGGAGGG - Intronic
1016761433 6:147741720-147741742 ATGGAAAAACAGGTTGAGTGTGG + Intergenic
1017262288 6:152401529-152401551 ATGGGCAAATAGAAAGAGGAAGG + Intronic
1017275128 6:152557270-152557292 ATGGAAAAAAAGGATGAAAAGGG + Intronic
1017315702 6:153028587-153028609 ATGGGAAAAGTGGATGGGGGGGG + Intronic
1017984004 6:159426608-159426630 ATGGAAAAACAGTATGTGCATGG + Intergenic
1018048240 6:159983903-159983925 ATGGGAAGAGAGGTTGTGGAAGG + Intronic
1018176542 6:161183025-161183047 ATGGGAGAAGAGGATGAGGAAGG + Intronic
1018214566 6:161514446-161514468 ATGGGGAAAAAGGGTGAAGAAGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018792336 6:167158007-167158029 TTGGGGAAAGAGGATGAGCAGGG + Exonic
1019410311 7:903900-903922 ATGGGAAGACAGGTGCAGGAAGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1019579714 7:1755104-1755126 ATGGGAAAAAAGGCTGGGCACGG - Intergenic
1019804659 7:3114458-3114480 ATGGCAAAAAAGGATGAGAGAGG - Intergenic
1020137358 7:5594509-5594531 ATGGGAAAACCAGATGCGGCGGG + Intronic
1021184730 7:17550847-17550869 ATGGGAAAAAAGGAAAAGAAAGG + Intergenic
1021317830 7:19171726-19171748 ATGGGAAGAAAGGAGTAGGAGGG + Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1021576262 7:22108721-22108743 ATGGGAAAAAAGGGTGAAGAAGG + Intergenic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1022219614 7:28300004-28300026 AACGGAAAACAGGATGAAAAGGG - Intronic
1024232472 7:47373108-47373130 ATGAGAAAACAGGATAGGAACGG - Intronic
1024522864 7:50322291-50322313 ATGGGAAAAGAGGATGATTTAGG - Intronic
1024800159 7:53067880-53067902 TTGAAAAAAAAGGATGAGGATGG + Intergenic
1025832296 7:65063062-65063084 ATGGGCAAAATGCATGAGGATGG + Intergenic
1025902065 7:65752579-65752601 ATGGGCAAAATGCATGAGGATGG + Intergenic
1025908292 7:65806901-65806923 ATGGGAACACAGGGGGATGAGGG - Intergenic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026772391 7:73210838-73210860 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1026849132 7:73714060-73714082 ATGGGAGAAGAGGAGGAAGATGG - Intronic
1027013259 7:74764237-74764259 ATGGGGAAAGAGGAAGGGGACGG + Intergenic
1027074781 7:75181797-75181819 ATGGGGAAAGAGGAAGGGGACGG - Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1027936769 7:84615592-84615614 ATGGGAAATCACAAGGAGGAAGG + Intergenic
1028248258 7:88508995-88509017 AAGGCCAAGCAGGATGAGGAAGG - Intergenic
1028562929 7:92195299-92195321 ATGGGAAATAAGGAAGAGGTAGG - Intergenic
1029440127 7:100582827-100582849 ATGGGAAAACAGTAAGGCGAGGG + Intronic
1029487918 7:100854417-100854439 ATGGGAGGACATGATGGGGAGGG + Intronic
1029983836 7:104903382-104903404 AGGGGAAAACGGGGTCAGGAGGG - Intronic
1030676708 7:112392317-112392339 ATTGGAAGAGAGGATCAGGAAGG - Intergenic
1030748413 7:113198397-113198419 ATAGAAAAACAGGATGCTGATGG - Intergenic
1030800302 7:113841992-113842014 ATGGGCACAGAGCATGAGGAGGG - Intergenic
1031659257 7:124399840-124399862 ATGGGAAATCAGGCTATGGAGGG + Intergenic
1032727389 7:134603501-134603523 ATGGGAAAACTTGGTAAGGAAGG + Intergenic
1033106214 7:138527474-138527496 ATGGTAGAATAGGATGAGTAAGG - Intronic
1033609630 7:142953343-142953365 AGGGGAAGAAAGGAAGAGGAGGG - Intronic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1035981032 8:4372358-4372380 AATGGAAAACAGCATGTGGAAGG - Intronic
1036023709 8:4878982-4879004 ATGGGAGAACAGGATGGGTGAGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1038902487 8:31859333-31859355 ATGGAAAAACAAGATTATGATGG - Intronic
1038916332 8:32027689-32027711 ATGGGAATACTGGGTGATGAAGG + Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039245964 8:35608554-35608576 AGTGGAAACCAGGAAGAGGAGGG - Intronic
1039427177 8:37495523-37495545 TTGGGAAGACGGGATGAGGAAGG - Intergenic
1040706976 8:50140359-50140381 ATGGGAAATCTGGCTGAGAAAGG - Intronic
1041180599 8:55243813-55243835 AAGGGACAACTGGAAGAGGAAGG + Intronic
1041646019 8:60253511-60253533 ATGGGAAAAAAAGATGTGGATGG - Intronic
1041646054 8:60253728-60253750 ATGGGAAAGTAGCATGAGGCAGG - Intronic
1041898557 8:62955492-62955514 ATGTGATAAGAGGATGATGAAGG + Intronic
1042347540 8:67743015-67743037 TTGGGAAAACAGGGAGATGAGGG + Intronic
1042817397 8:72892427-72892449 ATGGGAAAAAAGGATGAAGTAGG - Intronic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1043372493 8:79611324-79611346 ATGGTAACACAGGACCAGGAAGG + Intronic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1045046853 8:98287033-98287055 ATTGGAACATAGGATGGGGAAGG + Intronic
1045562299 8:103276502-103276524 ATAGTAAAAAAGGATGAGGTGGG - Intergenic
1046395246 8:113632635-113632657 ATGGGAAGAGAGGATGGAGAGGG - Intergenic
1048128570 8:131665465-131665487 ATTGGAAGACAGGAAGATGAAGG - Intergenic
1048302595 8:133262501-133262523 ATGGAAAGAGAGGATCAGGAGGG - Intronic
1048305366 8:133280182-133280204 AAGAGAAGACGGGATGAGGAAGG + Intronic
1048357034 8:133661982-133662004 ATGGGAAAAAAGAACGAGGGTGG + Intergenic
1049030089 8:140028794-140028816 ATGAGAATACAGGAGGAGAAAGG + Intronic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1051609215 9:18945132-18945154 AAGGGAAAACTGGAGGAGAATGG - Intronic
1052079732 9:24189186-24189208 ATTGGATAACAGAATGAGGGAGG - Intergenic
1053316351 9:37055170-37055192 CTGGGAAAACTGGTTGAAGATGG - Intergenic
1053321343 9:37101538-37101560 CTGGGAAAACTGGTTGAAGATGG - Intergenic
1053336983 9:37283548-37283570 ATAGGAAAACAGGAAAAAGAGGG - Intronic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1055013130 9:71589135-71589157 ATGGGAACACTGCATGAGAAGGG - Intergenic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055402847 9:75942754-75942776 ATAGGAAAAGAGTATGATGAGGG + Intronic
1055639176 9:78306145-78306167 ATGGTAACAAAGGATGAGGCTGG + Intronic
1056376884 9:86023446-86023468 AGAGGAAAACAGAATGAGCATGG + Intergenic
1057627455 9:96690347-96690369 ATGGGAAAACAGGAGGTAGTAGG - Intergenic
1057900970 9:98947959-98947981 ATGGGAAAACAGGCTCAGAGTGG - Intronic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058168781 9:101652901-101652923 ATGTGAAAACAGGATTATAATGG - Intronic
1058479786 9:105380154-105380176 ATGGAAAAACAGGCTCAGAATGG + Intronic
1058719085 9:107747341-107747363 ATGAGAAAGGAGGATGAGGAGGG + Intergenic
1059024964 9:110616582-110616604 TGGGGAAAAAAGGAAGAGGAAGG - Intergenic
1059071609 9:111143379-111143401 ATGGGAAAAAATGAAGTGGAGGG - Intergenic
1059229825 9:112709377-112709399 ATGGGAAAACAGAATGAATAAGG + Intronic
1059624563 9:116048761-116048783 TTGGGAAAACAGGATGGAGGAGG - Intergenic
1059986026 9:119821484-119821506 ATGAAAATAAAGGATGAGGAAGG - Intergenic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060196283 9:121625635-121625657 ATGGGATGGCAGGATCAGGAGGG + Intronic
1060445280 9:123681444-123681466 CTGTAAAAACAGGGTGAGGAGGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1185823746 X:3229022-3229044 ATGGGGAAACAGGGGGAGTAAGG + Intergenic
1185827696 X:3268010-3268032 TTGGGAAAAAAATATGAGGATGG - Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186270490 X:7881511-7881533 ATGGGAAAACAGAGTGATCAAGG - Intergenic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186926880 X:14343443-14343465 ATGGGAATTCAAGATGAGGTTGG - Intergenic
1187261551 X:17689215-17689237 AAAGGAAAAAAAGATGAGGAAGG - Intronic
1187979397 X:24739064-24739086 ATGGGAAAACAGCAGGGTGAGGG - Intronic
1188513679 X:30962770-30962792 ATGGGAAATCAAGATGATCAAGG + Intronic
1190789102 X:53683252-53683274 ATGGGACGACAGAATTAGGAGGG + Intronic
1191688971 X:63920703-63920725 ATGGGGAAACAGGATCAGACAGG - Intergenic
1192140170 X:68640099-68640121 ATGGGAAACTAGAATGAGAAAGG - Intergenic
1192327734 X:70147452-70147474 AGGGGAAGAGAGGAAGAGGATGG + Intronic
1192787344 X:74348073-74348095 ATGGGAAAAGGGGGTGAGGGTGG - Intergenic
1193268647 X:79504288-79504310 TTGGGAAAAGAGATTGAGGAAGG + Intergenic
1193426777 X:81349126-81349148 ATGGGGTTACAGGAAGAGGAGGG - Intergenic
1194156112 X:90391255-90391277 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1195018616 X:100802757-100802779 AGGGGAAAAAAAGATGATGAAGG + Intergenic
1195158913 X:102152465-102152487 CTGGGAGAAGGGGATGAGGAAGG + Intergenic
1195374560 X:104214097-104214119 AGGGGAAGAGAGGATGAGGGAGG + Intergenic
1195385151 X:104307004-104307026 ATGGGAAAACAGGCTCAGAGTGG - Intergenic
1195478610 X:105317040-105317062 ATGAGAAAATAGGATTAGAATGG - Intronic
1195581508 X:106509190-106509212 GAGGGAAAACAGGAAGAGTATGG - Intergenic
1196610794 X:117712516-117712538 ATGTGGAAAAAGGATGAGAAAGG + Intergenic
1196906304 X:120439858-120439880 AAGTGGAAACAGGATCAGGAAGG + Intronic
1197412708 X:126138858-126138880 ATGGGCAACCAGGATGCGGGGGG + Intergenic
1198054399 X:132979402-132979424 ATGGGAAAAGGGGGTAAGGAAGG + Intergenic
1198993512 X:142545091-142545113 AGAGGAAAACTGGATGAGAAAGG - Intergenic
1199243328 X:145574076-145574098 AGAGGAAGACAGGATGATGAGGG + Intergenic
1199321172 X:146440990-146441012 AAGAGAAAACAGGGGGAGGAAGG + Intergenic
1200502458 Y:3968228-3968250 ATGGGAAAATGGCAAGAGGAAGG - Intergenic
1200754053 Y:6973239-6973261 ATGGGGGAAGATGATGAGGAGGG - Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic