ID: 986834251

View in Genome Browser
Species Human (GRCh38)
Location 5:11617073-11617095
Sequence CTGTGGCTATGCATGTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986834248_986834251 1 Left 986834248 5:11617049-11617071 CCATCATATCTACTCGTATCAGA 0: 1
1: 0
2: 1
3: 5
4: 52
Right 986834251 5:11617073-11617095 CTGTGGCTATGCATGTGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986834251 Original CRISPR CTGTGGCTATGCATGTGCCA AGG Intronic
No off target data available for this crispr