ID: 986835187

View in Genome Browser
Species Human (GRCh38)
Location 5:11629366-11629388
Sequence TGACAGCTGTTTTCTACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 234}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986835187 Original CRISPR TGACAGCTGTTTTCTACAGG TGG Intronic
900990106 1:6094734-6094756 TAGCAGATGTGTTCTACAGGTGG - Intronic
901336561 1:8454425-8454447 TGGCAGCTGTGTTTGACAGGAGG - Intronic
903159253 1:21473293-21473315 TGCTAGCTGGTTTCGACAGGAGG - Intronic
905561699 1:38932334-38932356 TCACAGCTGTATTCAACTGGTGG - Intronic
906706584 1:47899495-47899517 AGACAGCAGTTTTCTAGAGGTGG - Intronic
907251311 1:53141658-53141680 TGAGAACTGTTTTCAAAAGGGGG - Intronic
907560485 1:55382976-55382998 GGACAGATGTTTTCTGCTGGTGG + Intergenic
907568442 1:55459659-55459681 TCACAGCTGAATTCTACAAGAGG + Intergenic
911399150 1:97353019-97353041 TGACAGTTCTTTTCTACTGCTGG - Intronic
911504328 1:98729806-98729828 TTACAGCTGAATTCTACAAGGGG + Intronic
912435580 1:109658792-109658814 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912437374 1:109671265-109671287 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912439965 1:109690249-109690271 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912443321 1:109714925-109714947 TGACAGCTGTTTTCTGCCTCAGG + Exonic
912917231 1:113827342-113827364 TAACAGTGGTTATCTACAGGAGG - Intronic
913506541 1:119521673-119521695 TCACAGCTGAATTCTACTGGAGG - Intergenic
914551929 1:148722686-148722708 GGACAACTGTTCTCTAAAGGAGG + Intergenic
916611419 1:166395689-166395711 TGCCAGCTGTTTACTATAGGGGG - Intergenic
917132954 1:171761200-171761222 TGACTGCTGTTTTTTCCAGAAGG + Intergenic
918089090 1:181272417-181272439 TGATACAAGTTTTCTACAGGTGG - Intergenic
918823579 1:189291911-189291933 TTACATCTGTTTTCTACACATGG - Intergenic
919060299 1:192623433-192623455 TCACAGCCGAATTCTACAGGAGG - Intergenic
924652598 1:245943529-245943551 TGACAGCTGAATTCTACAAGAGG + Intronic
1063497927 10:6527322-6527344 TGACTGCTGTTTTCTAGATATGG - Intronic
1065845875 10:29742936-29742958 TGACAGCTGCTTTGAAAAGGAGG - Intergenic
1066104227 10:32142815-32142837 TGTGAGCGGTTTTCTCCAGGTGG - Intergenic
1066483510 10:35821607-35821629 TGACAGCTCTTCTCAGCAGGGGG - Intergenic
1068382221 10:56271071-56271093 TGGCAGCTATTTCTTACAGGTGG + Intergenic
1069912058 10:71765772-71765794 AGACAGCTTTTTTCTAAAAGGGG - Intronic
1070536032 10:77377824-77377846 TAACTGCTGTTTTACACAGGAGG - Intronic
1073814404 10:107190331-107190353 TTTCAGTTGTTTTCAACAGGGGG + Intergenic
1074795166 10:116935759-116935781 TCACAGCTGATTTCTACCAGAGG - Intronic
1076204220 10:128582192-128582214 TGACATCTGTTTCCTGAAGGTGG + Intergenic
1076291149 10:129346757-129346779 TGGCAGCCGTTTTCTCAAGGTGG + Intergenic
1078727996 11:13949327-13949349 GGACATCTGGTTTCTAGAGGGGG + Intergenic
1079920240 11:26424777-26424799 TGACTGATGTTTTCTATAGTAGG - Intronic
1082661993 11:55923139-55923161 TGACAACTGTTTTCCAAAGAAGG - Intergenic
1082727562 11:56754608-56754630 TGACAGCTTCTTTCATCAGGAGG + Intergenic
1083138589 11:60703198-60703220 AAACAGTTGTTTTCTCCAGGCGG + Intronic
1083295302 11:61712133-61712155 TGACTGCTGTTTTATAGGGGAGG + Intronic
1086132495 11:83415583-83415605 TCACAGCTGAATTCTACCGGAGG - Intergenic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1091641762 12:2242410-2242432 TGACAGGTGTTTCCTAAAGGTGG + Intronic
1091908928 12:4213065-4213087 TGACAGCTGTGTTCTCCAGAAGG - Intergenic
1092843412 12:12563376-12563398 TTAAAAATGTTTTCTACAGGAGG + Intergenic
1093813755 12:23518248-23518270 TCACAGCTGTATTCTACCAGAGG - Intergenic
1094657125 12:32431154-32431176 TGACAGCTGCTCTCTACAAGTGG - Intronic
1097179645 12:57164250-57164272 TAACAGTGGTTATCTACAGGTGG - Intronic
1097304709 12:58056265-58056287 TCACAGCTGAATTCTACAAGAGG - Intergenic
1097440426 12:59601504-59601526 TGACAGTATTTTTCAACAGGTGG + Intronic
1100761057 12:97807759-97807781 TCACAGCTGAATTCTACAGGAGG + Intergenic
1100811521 12:98343390-98343412 TGACAGTTGCTGTCTACAGCTGG + Intergenic
1102018381 12:109663663-109663685 TGACCCCTGCTTTCTACAGTGGG - Intergenic
1102725313 12:115059066-115059088 TGACAGCTGTCTTCCAAGGGTGG - Intergenic
1107466508 13:40655465-40655487 TGAAAGCTATTTTCTCCACGTGG + Intronic
1107939831 13:45373801-45373823 TTAGAGTTGTTATCTACAGGAGG - Intergenic
1108821545 13:54356985-54357007 TGCCAGCTTTTTTCTAAAAGAGG - Intergenic
1110525665 13:76533701-76533723 TTACAGCTGAATTCTACTGGTGG + Intergenic
1111171592 13:84533801-84533823 TAACAGGAGTTTTCTACAGTTGG + Intergenic
1112210781 13:97375069-97375091 TGACAGCTTTTCTGTGCAGGTGG + Intronic
1115409380 14:33055722-33055744 TGACTGCAGTTTTCTAAAAGTGG + Intronic
1115728945 14:36247317-36247339 TCACAGCTGATTTCTACCAGAGG + Intergenic
1117523887 14:56578408-56578430 TGCCAGCTGTTGGCTAGAGGCGG + Intronic
1119018143 14:71081462-71081484 TGACAGCTGAATTCTACCAGAGG - Intronic
1120056908 14:79934881-79934903 TCACAGCTGATTTCTACCAGAGG - Intergenic
1120442655 14:84559640-84559662 TGACAGCTGTTTTGAACAAAGGG + Intergenic
1120586589 14:86319270-86319292 TGACAGGTGTTTCCTGTAGGAGG + Intergenic
1124197259 15:27642653-27642675 TTACAGCTGAATTCTACTGGAGG + Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128422664 15:67508838-67508860 TGACAGTGGTTATCTCCAGGTGG - Intergenic
1129963558 15:79712491-79712513 TCACAGCTGAATTCTACTGGAGG + Intergenic
1131903044 15:97109907-97109929 TCACAGCTGAATTCTACTGGAGG + Intergenic
1133542150 16:6766665-6766687 TGACAGCTGTTGGCCACATGTGG - Intronic
1136992541 16:35163557-35163579 TCACAGCTGATTTCTACCAGAGG + Intergenic
1138192795 16:55030256-55030278 TTATAGCTGTTGTCTGCAGGAGG + Intergenic
1139812361 16:69632220-69632242 TAAAAGCTGTCTCCTACAGGAGG - Intronic
1140748467 16:78002003-78002025 TGACATTTGATTTCTCCAGGAGG + Intergenic
1141449915 16:84092062-84092084 AGGCAGCTGTGTTCTGCAGGTGG + Intronic
1150300870 17:64045927-64045949 TCACAGGTCTTTTCTACTGGTGG - Intronic
1152978645 18:250678-250700 TGACAGCTGTTATCACCAGATGG - Intronic
1153221155 18:2862815-2862837 TCACAGCTGTATTCTACCAGAGG - Intronic
1153385240 18:4486012-4486034 TGAGTGCTGTTTTCTACAATTGG + Intergenic
1153511479 18:5858649-5858671 TCACAGCTGATTTCTACCAGAGG - Intergenic
1153637817 18:7128296-7128318 TGGCACCTGTCTTCCACAGGTGG + Intergenic
1155664890 18:28296640-28296662 TCACAGCTGAATTCTACCGGAGG + Intergenic
1155788285 18:29930422-29930444 GGACAGATGGATTCTACAGGAGG - Intergenic
1156833914 18:41529534-41529556 ACTTAGCTGTTTTCTACAGGTGG - Intergenic
1157790463 18:50526589-50526611 GGCCAGCAGTTTTCTGCAGGGGG - Intergenic
1157986385 18:52442921-52442943 TGACAGCTGTTCTCTTCATGTGG - Intronic
1158795168 18:60837377-60837399 TGACAGCTGTACTGTTCAGGAGG - Intergenic
1159710289 18:71749646-71749668 TGAGAAGTGTTTTCTGCAGGTGG - Intronic
1165262158 19:34628664-34628686 TCACAGCTGATTTCTACCAGAGG + Intronic
1166248846 19:41551669-41551691 TGAGAACTTTTTTCTTCAGGAGG + Intronic
1166403733 19:42504059-42504081 TGTCAACTGTTTTCTAGAGTGGG + Intergenic
1167624897 19:50581440-50581462 TCATAGCTGTTTTTTGCAGGAGG - Intergenic
1168440266 19:56359475-56359497 TTACAGCTGAATTCTACTGGAGG + Intronic
926229115 2:10989566-10989588 TGTCAGATGTTTTCTCCAGCAGG - Intergenic
926716612 2:15929108-15929130 TAACTGCTGATTTCCACAGGTGG + Intergenic
929343664 2:40854571-40854593 TCACAGCTGAATTCTACTGGAGG + Intergenic
930248752 2:49012006-49012028 TGACATGTGCTTTCTTCAGGTGG - Intronic
930913788 2:56662900-56662922 TCACAGCTGAATTCTACCGGAGG - Intergenic
931086563 2:58837712-58837734 TGAAAGCAGTTCTCTGCAGGTGG - Intergenic
931469930 2:62529304-62529326 AGAGAGCTTTTTTCCACAGGAGG - Intergenic
931700330 2:64903867-64903889 AGACTGCTGTTTCCTAAAGGTGG + Intergenic
932517149 2:72363335-72363357 GTTCAGCTGTTTTCTACAGATGG - Intronic
932697271 2:73967441-73967463 TGGCAGATGTTTACTACAGATGG + Intergenic
933460973 2:82585039-82585061 TGGAAGCTGTTTGCTTCAGGAGG - Intergenic
933665363 2:84960377-84960399 TTACAGCTGATTTTTAAAGGAGG + Intergenic
935234553 2:101127469-101127491 TGACGTCTGTTCTCTACACGTGG - Intronic
935648651 2:105363385-105363407 AGACAGCTGCTTCCTGCAGGCGG + Exonic
935720169 2:105972804-105972826 GGACAGGTGCTTTCTTCAGGGGG + Intergenic
939619542 2:144401326-144401348 TGACATCAGTTTTGTGCAGGAGG + Intronic
939845166 2:147234831-147234853 TCACAGCTGTTATTTAGAGGTGG - Intergenic
940054231 2:149496862-149496884 TCACAGCTGAATTCTACAAGAGG - Intergenic
940433661 2:153624693-153624715 TGAAAGCTATTTTCTAAAGTGGG - Intergenic
941936381 2:170984457-170984479 AGACAGCTCTCTTCTCCAGGTGG - Intergenic
942576656 2:177370802-177370824 TCACAGCTGAATTCTACAAGAGG - Intronic
942909482 2:181225773-181225795 TGGCAGCTGTGTTTTCCAGGAGG + Intergenic
943161975 2:184266085-184266107 TCACAGCTGAATTCTACTGGAGG + Intergenic
943442294 2:187940746-187940768 TCACAGGTGTTTTCTCCAGGGGG - Intergenic
943552161 2:189354374-189354396 TCACAGCTGAATTCTACAAGAGG - Intergenic
946176403 2:217924437-217924459 TGACACTTGTTTTCTAGAGGAGG - Intronic
948250993 2:236528893-236528915 TCACAGCTGTTTTCTGGATGAGG - Intergenic
948343098 2:237270799-237270821 GGATAGATGTTTTCAACAGGAGG - Intergenic
1173047178 20:39523666-39523688 AGGCAGCTGTTTTATAAAGGAGG + Intergenic
1176306557 21:5126596-5126618 TGTCAGCTGTTGTCCCCAGGAGG - Intronic
1178535879 21:33410094-33410116 TTACAGATGTATTATACAGGAGG + Intronic
1179820313 21:43933440-43933462 TGCCATCTGTTTTCTCCATGGGG + Intronic
1179850502 21:44135434-44135456 TGTCAGCTGTTGTCCCCAGGAGG + Intronic
1180731761 22:17987579-17987601 TGGCAGCTGTTCCATACAGGTGG - Intronic
1184699791 22:46162970-46162992 TGCCTGCTGTTTTCCACAGCAGG - Intronic
951361132 3:21725728-21725750 TGACAGCTGAATTCTACCAGAGG + Intronic
952503404 3:33985777-33985799 TGACAGCTGAATTCTACCAGAGG - Intergenic
953241607 3:41154381-41154403 TGGCTGCTGTTGTCTACAAGTGG - Intergenic
954242225 3:49302921-49302943 TGAGGGCTGTTATGTACAGGAGG - Intronic
955680466 3:61495115-61495137 TCACAGGTGTCATCTACAGGTGG - Intergenic
956899351 3:73698211-73698233 TAACAACTGTTTTCTACAAAAGG - Intergenic
958159429 3:89798661-89798683 TGAGATCTGTATTCTAGAGGTGG - Intergenic
958480035 3:94634180-94634202 TCACAGCTGAATTCTACAAGAGG + Intergenic
958621785 3:96571879-96571901 TCACAGCTGAATTCTACAAGAGG - Intergenic
959090745 3:101900069-101900091 TGACAACTGTTTGCTAGAAGGGG + Intergenic
960085322 3:113584357-113584379 TCACAGCTGTTTTCTTCACATGG + Intronic
960736262 3:120784530-120784552 TGACAGTTCTTTTTTGCAGGTGG + Intergenic
962067944 3:132002873-132002895 TGACAGCTGTTGTCTTCATTGGG - Intronic
963070172 3:141298131-141298153 TCACAGCTGAATTCTACCGGAGG - Intergenic
963587287 3:147208255-147208277 TTACAGCTGAATTCTACCGGAGG - Intergenic
965904794 3:173690411-173690433 TGACAGCTTATTTCTAGATGTGG - Intronic
967410538 3:189162491-189162513 TGAAAGCTTTTTTGAACAGGAGG + Intronic
967475159 3:189908094-189908116 TGACTGCTTTTCTCTACAGATGG + Intergenic
969189247 4:5503515-5503537 TGACAGCTGTTTGCTAAACGTGG - Intergenic
970846184 4:20540353-20540375 TAAAAGCTGTTTACTAGAGGGGG + Intronic
973688301 4:53397686-53397708 TGCCAGCTGTGTTTTCCAGGAGG + Intronic
974127956 4:57718674-57718696 TCACAGCTGAATTCTACAAGAGG + Intergenic
974263638 4:59557067-59557089 TCACAGCTGATTTCTACCAGAGG - Intergenic
975215938 4:71754608-71754630 TGGCAACTATTTTCTACAGAAGG + Intronic
975434584 4:74336147-74336169 TGACAGCTGCTTTGAACAAGGGG + Intergenic
975860554 4:78672301-78672323 TGACAGGTTGTTTCTACAAGTGG + Intergenic
975993970 4:80292431-80292453 TGACAGCTTTTTTTTTCACGTGG - Intronic
976533998 4:86190339-86190361 TCACAGCTGAATTCTACTGGAGG - Intronic
978418717 4:108506632-108506654 TCACAGCTGAATTCTACAAGAGG + Intergenic
978919794 4:114169657-114169679 TGGCAGCTGCTTTCTAGATGAGG - Intergenic
979803060 4:124935998-124936020 CTACTGCTGTTTCCTACAGGGGG + Intergenic
981885122 4:149665306-149665328 TGCCAGTAGTTTACTACAGGAGG - Intergenic
984372726 4:178887487-178887509 TCACAGCTGATTTCTACCAGAGG + Intergenic
984384117 4:179033463-179033485 TCACAGCTGATTTCTACCAGAGG + Intergenic
984388339 4:179094227-179094249 TGAAAGCTGACTTATACAGGTGG + Intergenic
984660462 4:182368811-182368833 TGACAGCTGTCAACTACAGATGG - Intronic
985668571 5:1194815-1194837 TGACAGCGTTTTCCTCCAGGAGG + Intergenic
985807957 5:2061170-2061192 TCACAGCTGAATTCTACCGGAGG - Intergenic
986835187 5:11629366-11629388 TGACAGCTGTTTTCTACAGGTGG + Intronic
987333899 5:16881555-16881577 AAACAGCTGTCTTCCACAGGTGG + Intronic
987629289 5:20446920-20446942 TTACATCTGTTTTCTAAAGGTGG - Intronic
992183159 5:74217991-74218013 TCACAGCTGAATTCTACTGGAGG + Intergenic
992577869 5:78137691-78137713 TTACAGCTGTTTTCTATGGTAGG + Intronic
993008461 5:82453835-82453857 TGACAGCTGAATTCTACCAGAGG - Intergenic
993043799 5:82844659-82844681 TGACAGCTGAATTCTACCAGAGG - Intergenic
994010717 5:94899194-94899216 TGACATCTGTTTTATACTGATGG + Intronic
994118750 5:96090511-96090533 TGGCAGCTGTTTAGTTCAGGGGG + Intergenic
996172619 5:120312722-120312744 TCACAGCTGAATTCTACAAGAGG - Intergenic
996638682 5:125727500-125727522 TGAGAGCTTATTTCTACATGTGG - Intergenic
997706705 5:135961190-135961212 TTACAGCTGAATTCTACAAGAGG + Intergenic
998324249 5:141265124-141265146 AGACATCTCTTTTCTACAGCTGG - Intergenic
1004838037 6:19550345-19550367 TGACATTTCTTTGCTACAGGAGG + Intergenic
1006969000 6:38020822-38020844 TGACAGCTGTTTAATACGAGAGG - Intronic
1008581516 6:52912457-52912479 TGAGATTTGTTGTCTACAGGGGG - Intergenic
1008778171 6:55066547-55066569 TGGCAGCAGTTATCTAAAGGAGG + Intergenic
1009807126 6:68614259-68614281 GGTCAGCTGTTTTTTACAAGTGG - Intergenic
1010696449 6:78980242-78980264 TGACAGATTTTTTCTACAGAAGG - Intronic
1012130037 6:95479339-95479361 TGGCAGCTGCTAGCTACAGGTGG - Intergenic
1012434508 6:99200974-99200996 TCACAGCTGATTTCTACCAGAGG - Intergenic
1013803033 6:113969486-113969508 TGGAAGCTGTTTCCTACATGTGG - Intronic
1015000014 6:128202801-128202823 TGACAGCTGAATTCTACCAGAGG + Intronic
1015308199 6:131734057-131734079 GCACAGCTGTATTCTCCAGGTGG - Intronic
1017501195 6:155024826-155024848 TCACAGCTTTTATTTACAGGTGG + Intronic
1017829707 6:158115380-158115402 TGAAAGCTGTGTTCTCCATGGGG - Intronic
1020495910 7:8853187-8853209 TGACAGCTATTTCCTATAGGTGG - Intergenic
1021064940 7:16161779-16161801 TCACAGCTGATTTCTACCAGGGG - Intronic
1021388722 7:20065996-20066018 TAATAGCTGTTTTCTAAAGCAGG + Intergenic
1023990160 7:45124039-45124061 TGAGAGGTGTTCTCTGCAGGGGG + Intergenic
1024718796 7:52111096-52111118 TGCTAGTTGTTTTCAACAGGAGG - Intergenic
1028658933 7:93244764-93244786 GGACAGGTGTCTTCTGCAGGTGG + Intronic
1029855175 7:103508081-103508103 TCACAGCTGTATTCTACCAGAGG + Intronic
1030132398 7:106213495-106213517 TCACAGCTGAATTCTACAAGAGG + Intergenic
1030390914 7:108927632-108927654 TCACAGCTGAATTCTACAAGAGG - Intergenic
1031146633 7:118004059-118004081 AGTCAGTTGTATTCTACAGGTGG + Intergenic
1032187438 7:129739141-129739163 TGATAGCTGTTAGCTACATGTGG + Intronic
1032977294 7:137240225-137240247 TGACTGCTGTGTTCTACTGGTGG - Intronic
1033652959 7:143355906-143355928 TGGCAGCTGAGATCTACAGGGGG - Exonic
1035869659 8:3123629-3123651 TGATTGCTGGTTTCTAGAGGAGG + Intronic
1036487724 8:9194767-9194789 TGAAAGTTGTTCTCTGCAGGAGG - Intergenic
1037248775 8:16868189-16868211 TGACAGTTATTTACTACAGTTGG + Intergenic
1037603367 8:20417577-20417599 AGACAGGTGTTTTGCACAGGGGG + Intergenic
1040403005 8:47071537-47071559 TGACAGCTGAATTCTACCAGAGG + Intergenic
1040473482 8:47756547-47756569 TGACAGCTGAATTCTACCAGAGG - Intergenic
1045146571 8:99352039-99352061 TTACAGCTTTATTCTAAAGGAGG - Intronic
1045343399 8:101273709-101273731 TGACAGTGGTTTTCTAAATGAGG - Intergenic
1046925344 8:119781052-119781074 TCAAAGCTATTTTCTACAGAAGG - Exonic
1048149497 8:131880293-131880315 TCACAGCTGAATTCTACAAGAGG - Intergenic
1049070998 8:140356069-140356091 TGTCAGCGTTTTTCTCCAGGTGG - Intronic
1051914208 9:22188477-22188499 TTACAGCTGAATTCTACAAGAGG + Intergenic
1051962590 9:22786298-22786320 TGACAGCCGTATTCTACCAGAGG - Intergenic
1052384916 9:27811178-27811200 TCACAGCTGAATTCTACTGGAGG + Intergenic
1053279601 9:36809898-36809920 TGACAGATCTCTGCTACAGGAGG - Intergenic
1055223263 9:73964551-73964573 TGACTGCTGTTTTCTGTATGGGG - Intergenic
1057693435 9:97307366-97307388 TGAGAGGTGCTTTCTGCAGGCGG + Intronic
1058333796 9:103800070-103800092 TGAAAGCTGATTTCTAAAGAAGG - Intergenic
1058393362 9:104522097-104522119 TAACAGTTGTTTGCTATAGGAGG + Intergenic
1058853268 9:109034011-109034033 TGACAGATATTTTCCTCAGGAGG - Intronic
1058950698 9:109901297-109901319 TCTCAGCTGTTTACAACAGGTGG - Intronic
1059531285 9:115037961-115037983 TGACAACTGTTTCCTAAACGGGG + Intronic
1059733708 9:117081261-117081283 TGGCATCTGTTTTCTTCACGTGG + Intronic
1061138751 9:128751746-128751768 TGGCAGGTGGTTTCTAAAGGTGG - Intronic
1061838021 9:133342022-133342044 TGACAGCTTTTTGCAAGAGGAGG - Intronic
1062063138 9:134508842-134508864 TCACAGCTGTATTCTACCAGAGG - Intergenic
1203573641 Un_KI270744v1:156211-156233 TCACAGCTGAATTCTACCGGAGG + Intergenic
1191198213 X:57747666-57747688 TCACAGCTGAATTCTACAAGAGG + Intergenic
1191768532 X:64729865-64729887 TTACAGCTGAATTCTACAAGAGG - Intergenic
1193309544 X:79989409-79989431 TTACAGCTGAATTCTACAAGAGG + Intergenic
1193542766 X:82791856-82791878 TCACAGCTGAATTCTACTGGAGG + Intergenic
1193991125 X:88308538-88308560 TGAGAGCTGCTTTCCACAGTGGG + Intergenic
1194263699 X:91730426-91730448 TTACAGCTGAATTCTACGGGAGG - Intergenic
1195562580 X:106300316-106300338 TAACAGCTGTTTTGTACAATGGG + Intergenic
1195970662 X:110469692-110469714 TCACAGCTGATTTCTACCAGAGG - Intergenic
1196012237 X:110900985-110901007 TGACAGCTGAATTCTACCAGAGG - Intergenic
1196349083 X:114704106-114704128 TCACAGCTGAATTCTACTGGAGG + Intronic
1196927735 X:120650169-120650191 TCACAGCTGAATTCTACAAGAGG + Intergenic
1197423746 X:126269911-126269933 TTACAGCTGAATTCTACAAGAGG - Intergenic
1197490412 X:127109709-127109731 TCACAGCTGAATTCTACAAGAGG + Intergenic
1199365724 X:146980035-146980057 TCACAGCTGAATTCTACAAGAGG - Intergenic
1199662451 X:150065774-150065796 GGACATCTGTTCTCTACAGCAGG - Intergenic