ID: 986835759

View in Genome Browser
Species Human (GRCh38)
Location 5:11635265-11635287
Sequence TGTTATCTTTAGAAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 474}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986835759 Original CRISPR TGTTATCTTTAGAAAGAAGA AGG Intronic
901436794 1:9251464-9251486 TGTTGTTGTTAGAAAGAAGGAGG + Intronic
902258957 1:15209730-15209752 TGTTATCTTTTTAAAAAATATGG + Intronic
903003603 1:20283847-20283869 TCTTATCTTTAGAGTGGAGATGG - Intergenic
903201936 1:21748290-21748312 TATTAATTTTAAAAAGAAGATGG + Intronic
903470437 1:23583166-23583188 TATTATCTTTTGACAGAGGAAGG - Intronic
903500443 1:23797531-23797553 TATTATCTTTAGAAACAAGCAGG + Intronic
904603445 1:31685890-31685912 GGTTATCTTGGGAAAGATGAAGG + Intronic
905224329 1:36469252-36469274 TGTTCTCTGTAGAGAGAAAATGG + Exonic
906027455 1:42685635-42685657 TGTTTTCTGTATAAAGGAGAGGG + Intronic
908663858 1:66467287-66467309 TGTTATTTTTATAAATAGGAAGG + Intergenic
908750762 1:67421008-67421030 TGCTATCTTTGGAAAGAAGCAGG - Intronic
908957174 1:69646968-69646990 TGTAATCTTTAGAATGACGTAGG - Intronic
909089864 1:71212004-71212026 TCTTTTCTTCAGAAAGAAAAGGG - Intergenic
909929255 1:81476475-81476497 TGTTCACTTTGGAAAGGAGAAGG - Intronic
910046924 1:82928639-82928661 TGACTTCTTTAGAAAGAAAAGGG - Intergenic
910416759 1:87009295-87009317 AGTAATCTTTGGAAAGAAGTAGG + Intronic
911145694 1:94550412-94550434 TTTTATTTTTATAATGAAGAGGG + Intergenic
911786249 1:101951889-101951911 TTCTATCTTTATAAAGAAGGTGG + Intronic
911937357 1:103994983-103995005 TGTTTTCTTCACTAAGAAGACGG - Intergenic
912032491 1:105265884-105265906 TGCTATGGTTAGAAAGGAGAAGG - Intergenic
912047219 1:105473777-105473799 TGTGATTTCTAGAAAGAACAAGG + Intergenic
912083354 1:105967509-105967531 TCTCATCTTTAAAAAGAAAATGG + Intergenic
912181465 1:107223871-107223893 GGTTATCCTTAGAATGGAGAAGG + Intronic
912413236 1:109491845-109491867 TGTTTTCTTTAGGAAGAGGTAGG + Intronic
912866948 1:113266340-113266362 GGTTACTTTTAGAAAGGAGAAGG + Intergenic
912965797 1:114236197-114236219 TGTAATGCTTAGAAAGAAGAGGG - Intergenic
913219277 1:116646313-116646335 CGTTATTTTTAGGAGGAAGATGG + Intronic
914752727 1:150546691-150546713 TGTTATCTCTAAGAAGATGATGG - Intergenic
915132237 1:153703537-153703559 TGTTATTTCTAGAAATAATAAGG - Intergenic
916688624 1:167170427-167170449 TGGTGTCTTTAGAAAGGAGAGGG - Intergenic
916869596 1:168898649-168898671 TGTAATTTTTAAAAAGGAGAGGG - Intergenic
917866010 1:179196203-179196225 TGTTCTCTTTGGAAATAACATGG + Intronic
917866556 1:179201218-179201240 TGTTCTCTTTGGAAATAACATGG + Intronic
919369883 1:196709711-196709733 TTTTATCTATAGAAAGGAAAAGG - Intronic
919491025 1:198204938-198204960 TGTTACATTTTAAAAGAAGAAGG - Intronic
919559387 1:199098154-199098176 TGTTACCTTTATATAGAAAAAGG + Intergenic
919668538 1:200317169-200317191 TGTTATCTTTAGACATTATAGGG - Intergenic
919734091 1:200934515-200934537 TTTTCTCTTTAGAAACGAGAAGG + Intergenic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
921555449 1:216593269-216593291 TGTTTTCTTTTTAAAGAAGAGGG + Intronic
921967138 1:221102235-221102257 AGTTAACATTAGAAAGGAGAAGG - Intergenic
922181307 1:223235172-223235194 TATTTTTTTTAGAAAGAAAAGGG - Intronic
923057288 1:230436440-230436462 TGTTATCTTGACAAAATAGAAGG + Intergenic
923094522 1:230763991-230764013 TTTTATGTTTAGAAACTAGATGG - Intronic
923445464 1:234066614-234066636 TTTTATCTTTGGGAAGGAGAAGG - Intronic
923819547 1:237422799-237422821 TGTTATCTTTGCATAGAATAGGG + Intronic
924293240 1:242559673-242559695 GTTTATCTCAAGAAAGAAGAAGG + Intergenic
1064445145 10:15386434-15386456 TATTATATGGAGAAAGAAGATGG + Intergenic
1064645696 10:17456548-17456570 TGTTATTTTTAAAGAGAAAATGG + Intergenic
1065348427 10:24772262-24772284 TGTTTTCTTTTGAAAAAAAAAGG - Intergenic
1065523862 10:26597813-26597835 TGGTTTCTTTGGAAAGAATAAGG - Intergenic
1065697507 10:28393377-28393399 TTTTATTTCTGGAAAGAAGAAGG - Intergenic
1065838759 10:29682624-29682646 TGTTGCATTTAGAAGGAAGAAGG + Intronic
1068934111 10:62619405-62619427 TGATATCTTCAGGCAGAAGAAGG - Intronic
1068949084 10:62759695-62759717 ATTTATCTTTAGGAAGAAGAAGG + Intergenic
1069009819 10:63359965-63359987 TGCTATCTTTAGAAAAGATAAGG - Intronic
1072347727 10:94525094-94525116 AGTTAACTTTATAAAGAATATGG - Intronic
1072975566 10:100054541-100054563 TTTTATCTTCACAAAGATGATGG + Intronic
1073315371 10:102577028-102577050 TGGTCTCTTCAGGAAGAAGATGG + Intronic
1073413238 10:103359862-103359884 TTTTATATTTAAAAATAAGATGG + Intergenic
1073660793 10:105473861-105473883 TGATATTTGCAGAAAGAAGAGGG - Intergenic
1074285016 10:112089941-112089963 TTTAATCTGTAAAAAGAAGAGGG - Intergenic
1074571747 10:114631016-114631038 TTTTATCTCTAGAGAGGAGAGGG + Intronic
1075415986 10:122264858-122264880 TGTTTTCTTTACAAGGAAGGTGG + Intergenic
1075967530 10:126625644-126625666 TGATACCTTTAGAAAAATGAAGG - Intronic
1077694437 11:4381666-4381688 TGTCCTCTTTGGAAAGAATAAGG + Intergenic
1078677815 11:13441435-13441457 TTTAATCTTTTGAAAAAAGAAGG + Intronic
1079581948 11:22076221-22076243 TATTTTCTTAAGAAAAAAGATGG - Intergenic
1079697888 11:23506568-23506590 TGTGAACTTTAGAAAGACAATGG + Intergenic
1080210329 11:29778560-29778582 TGTTATTTTTAGAACACAGAAGG - Intergenic
1080677334 11:34439857-34439879 GGTTATCTGTAGAATGTAGAGGG + Intronic
1080892966 11:36425519-36425541 GGTTATGTTTATAAGGAAGAAGG - Intronic
1081095868 11:38934428-38934450 TGTTTCTTTTAGAAAAAAGAAGG + Intergenic
1081179920 11:39972530-39972552 TGCTGTTTTTAGAAAGAACAAGG + Intergenic
1081185101 11:40032704-40032726 TGTTATCTATAGAAACAATTGGG + Intergenic
1082038712 11:47667156-47667178 GTTTGTCTTTAGAAAGCAGAGGG + Intronic
1082558485 11:54591419-54591441 TTTTACCTTTAGAAAAAAAAAGG - Intergenic
1083316964 11:61821364-61821386 TCTTTTCTTTAGAGAGAAAATGG - Intronic
1083425034 11:62579169-62579191 GGTTATCTTTAAAAAAAAAAAGG - Intronic
1083480627 11:62943259-62943281 TGCTCTTTTTAGAAAGAACAAGG - Intronic
1084684308 11:70684860-70684882 TGTACCCTTTAGGAAGAAGAAGG + Intronic
1087260724 11:96008646-96008668 TGTTAACTTTATGGAGAAGAGGG - Intronic
1087856553 11:103098500-103098522 TGTTTTCTTTATAAACAAGAAGG - Intergenic
1089712860 11:120329051-120329073 TGTTATCCTTAGAAGGGATAAGG - Intronic
1091039114 11:132260255-132260277 TCTTATCTTTAAAAAAAAAAAGG - Intronic
1092593340 12:9972788-9972810 ATTTTTTTTTAGAAAGAAGAAGG + Intronic
1092938254 12:13383977-13383999 TGTCAGCTTTAGAAAAATGAGGG + Intronic
1093494156 12:19736243-19736265 TGTTTTCTGTAGATAGAAAATGG + Intergenic
1093630785 12:21406937-21406959 TGTTTTCTTTTGAGAAAAGATGG - Intronic
1094282029 12:28750785-28750807 TGTTAACTATTGAAACAAGATGG - Intergenic
1095647816 12:44569846-44569868 TTTTCTCTTTAAAAAGAATAAGG + Intronic
1096430029 12:51535321-51535343 TGTTAGCTTTAGAGAAAACAGGG - Intergenic
1097324931 12:58265862-58265884 TGTTAGCATTAGCAATAAGATGG + Intergenic
1097563801 12:61241496-61241518 AATTATCTGTAGAAAAAAGATGG - Intergenic
1098240981 12:68466854-68466876 AGATATCTCTAGAAAGCAGAGGG + Intergenic
1098664336 12:73141727-73141749 TGGTATTTTTTGAAAGAAAAAGG - Intergenic
1098832806 12:75383265-75383287 TGGTTTCTGTAGAAAGAAGTGGG - Intronic
1099160504 12:79235523-79235545 TGGTATATTTACAAAGCAGAAGG - Intronic
1099330868 12:81285085-81285107 TGTTTTATTTAGAAAGCAAATGG - Intronic
1099769601 12:87034117-87034139 TGTCATTTTTATAAAGAAAAAGG - Intergenic
1099812566 12:87603613-87603635 TGTTCTTTTTAGAAAGCAGGGGG - Intergenic
1100152777 12:91761088-91761110 TGTTATACTTTGAAAGCAGATGG + Intergenic
1101247280 12:102896076-102896098 TGTTATCATGAGAAAGACTAAGG + Intronic
1101303585 12:103505105-103505127 TGTGTTCCTTAAAAAGAAGATGG + Intergenic
1101704130 12:107204975-107204997 TGTTATGTTTTGGAAGCAGATGG - Intergenic
1101771636 12:107757121-107757143 TCTTATCAGTAGAAAGAATATGG - Intronic
1102244924 12:111349473-111349495 GGTCAACTTGAGAAAGAAGATGG - Exonic
1103123316 12:118399200-118399222 TGAAATATTTAGTAAGAAGATGG + Intronic
1103528579 12:121583769-121583791 TGAAATCATTAGAAAGAATAAGG - Intergenic
1103812457 12:123626483-123626505 TGTCATCTTCAGTAAGAAAATGG - Exonic
1104380841 12:128306558-128306580 TGTTATTTTTAGAAAGCTAAAGG + Intronic
1104668686 12:130666154-130666176 TATTAATTTTAGAAAGAAGGGGG - Intronic
1105817208 13:24047478-24047500 TGTTAACTTTAAAACAAAGACGG - Intronic
1106051794 13:26197406-26197428 TGTAATCATTAGAAAGCATAGGG + Intronic
1108605866 13:52038004-52038026 TGGTATTTTTAGAAAGGAAAGGG + Intronic
1109352098 13:61195840-61195862 TCTAATGTTTAGAAAGGAGAAGG + Intergenic
1109708547 13:66132299-66132321 TAATTTCTTAAGAAAGAAGAAGG - Intergenic
1109811314 13:67516345-67516367 TTTTATCTTTACAAAGAAACTGG - Intergenic
1109900112 13:68757347-68757369 TCTTTTCTGTAGCAAGAAGAGGG + Intergenic
1110100979 13:71601599-71601621 TGTTTTGTTTAGAAAAAAGACGG - Intronic
1111224448 13:85251653-85251675 TGTTACTTTAAGAAAGCAGAGGG + Intergenic
1111824085 13:93246449-93246471 TGTTTTCTTTGCAAAGAAAATGG - Intronic
1113541052 13:111109987-111110009 AGTTATATTTAGAAGGAAAAGGG + Intergenic
1113582451 13:111438721-111438743 TATTACCATTTGAAAGAAGAGGG - Intergenic
1114136016 14:19851922-19851944 TGTTATGTGGAGAATGAAGATGG - Intergenic
1114723515 14:24909052-24909074 TGTTATCTTTAGGGATAAGCAGG + Intronic
1115170449 14:30499019-30499041 TATTATCTGTAGATAGAAGATGG - Intergenic
1115171523 14:30513285-30513307 TGTTATCTTTAAGAATAAGATGG + Intergenic
1115223465 14:31080326-31080348 ATTCATCTTTAGAAAGCAGAGGG - Intronic
1116070555 14:40039251-40039273 GGTTATGTTTAAAAAGAATAGGG + Intergenic
1116145158 14:41057354-41057376 TGTGATGTTAAGTAAGAAGATGG - Intergenic
1116544055 14:46140702-46140724 TGTTATCCTTAGGAAGGAGATGG - Intergenic
1117630742 14:57688609-57688631 TGTTTTCTTTATAATGAAGTTGG + Intronic
1118477808 14:66134726-66134748 AGGTACCTTGAGAAAGAAGAAGG - Intergenic
1118922478 14:70162181-70162203 TGTTAACTTCAAAAAGAATATGG - Intronic
1119311814 14:73653303-73653325 TGTGACCTTTAGTAAGCAGATGG + Intronic
1119504590 14:75161587-75161609 TTGTATCTTTAGCAAGATGATGG - Intronic
1119905930 14:78301946-78301968 TGGTATCTTTTGAAAGGAGGTGG + Intronic
1120006489 14:79363585-79363607 TTTTTTCTTAAGAAAGTAGAAGG - Intronic
1120565598 14:86052317-86052339 TGTAATTTTTCCAAAGAAGAAGG + Intergenic
1121210211 14:92202754-92202776 TATTAACTTTAGGAAGAGGATGG - Intergenic
1121231340 14:92361010-92361032 TTTAATCTTTAAAAAGGAGAGGG + Intronic
1121457958 14:94050873-94050895 TTTTTTTTTTAGATAGAAGATGG - Exonic
1121746776 14:96302156-96302178 TCTTATTTTTAAAGAGAAGAAGG - Intronic
1123504834 15:20930914-20930936 TGTTATGATTAGATAGAAAAAGG - Intergenic
1123562082 15:21504609-21504631 TGTTATGATTAGATAGAAAAAGG - Intergenic
1123598327 15:21941896-21941918 TGTTATGATTAGATAGAAAAAGG - Intergenic
1124086381 15:26554347-26554369 TGTTATCACTAGAAAAGAGATGG - Intronic
1124578885 15:30934245-30934267 TGTTAACATTAAAAAAAAGAAGG - Intronic
1125185309 15:36923286-36923308 TGATATCATCAGAAAGAATAAGG - Intronic
1125195750 15:37044103-37044125 TCTTATCTGTAGAATGGAGATGG - Intronic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1126806837 15:52358905-52358927 TGTTAGCTATAGATAGAAAAGGG + Intronic
1129277384 15:74455560-74455582 TGTTCTCATTAGAAAAAAGCTGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130608333 15:85337697-85337719 TATTACCTTTAGAAACAAAAAGG - Intergenic
1131088621 15:89600415-89600437 TTATATCTTTAAAAAGAACATGG - Intronic
1202970427 15_KI270727v1_random:231748-231770 TGTTATGATTAGATAGAAAAAGG - Intergenic
1133487802 16:6237219-6237241 TGTTATCTTGCTAAAGCAGAAGG + Intronic
1135748479 16:25037366-25037388 CATTATCTTGAGAATGAAGAAGG - Intergenic
1135758204 16:25115588-25115610 TATTATCTTGAGAATGAAAAAGG - Intronic
1136264914 16:29110159-29110181 TGATATCTTTAAAATGAACAAGG + Intergenic
1138702747 16:58881728-58881750 TGTTAAATTTAAAAAGAAAAAGG - Intergenic
1140752200 16:78035046-78035068 CGTTATCTTTAGGAAGACTATGG - Intronic
1140766530 16:78164615-78164637 TGTTAAGATTAGAAAGAAGGAGG + Intronic
1142053708 16:87978142-87978164 TGATATCTTTAAAATGAACAAGG + Intronic
1144174445 17:12691484-12691506 TGTTGGCTTCAGAAAGAAAACGG + Intronic
1144488525 17:15687367-15687389 TGAGATTTGTAGAAAGAAGATGG + Intergenic
1144912484 17:18694938-18694960 TGAGATTTGTAGAAAGAAGATGG - Intergenic
1145048665 17:19641056-19641078 TGTCATCTTTAGAATCAAGTTGG - Intergenic
1146064701 17:29625039-29625061 TGTTCTCTTTAAAGAGAAGGAGG - Intergenic
1146514962 17:33481984-33482006 TGTTTTCTAAAGAAAGGAGAGGG - Intronic
1146712624 17:35055783-35055805 TACTATCTTTAGAAACAATAGGG - Intronic
1147274435 17:39303530-39303552 TGTTATCATCAGTATGAAGAAGG + Intronic
1147678794 17:42225903-42225925 TTTTATCTTTAAAAAGCAGGGGG + Intronic
1147881301 17:43655521-43655543 TATTGTCTTCAGAAAGAAGGAGG + Intronic
1148702635 17:49598938-49598960 TTTTATATTTAGTTAGAAGAAGG + Exonic
1148721328 17:49755360-49755382 TGTTCTGTGTAGCAAGAAGATGG - Intronic
1148904028 17:50900219-50900241 TCCTCTCTTTAGAAAGAAAAAGG + Intergenic
1150598120 17:66625045-66625067 TGTGATCTATAGAAAGATGAAGG - Intronic
1153678351 18:7476389-7476411 TATTCTCTTTAGAAACAAGAAGG - Intergenic
1155168543 18:23250062-23250084 TGTTATATCTACAAATAAGATGG + Intronic
1155277107 18:24199029-24199051 TGTTATCTTTAGTAAAGATAGGG + Intronic
1155616275 18:27725163-27725185 TGTTATCTTTAATAAGAAACTGG + Intergenic
1155663595 18:28281182-28281204 TGTGATCTTTAGGAAATAGAAGG + Intergenic
1155697936 18:28706049-28706071 AGTTAACTTTAGCAAGAGGAGGG + Intergenic
1157111966 18:44829248-44829270 TGCAATCTTGAGAAACAAGAAGG - Intronic
1157691483 18:49685608-49685630 GGTAATCTTTAGAAACAAAAAGG - Intergenic
1157922663 18:51729503-51729525 TATTATCCTTATAAAGAATATGG - Intergenic
1158404585 18:57149896-57149918 CGTTATTTTTAAAAAGAAGAAGG - Exonic
1158611948 18:58948939-58948961 TGGTATATTTAGAAAAATGAAGG + Intronic
1158977320 18:62722637-62722659 TATTATCTTTAGAAAGCCAAAGG - Intronic
1159524899 18:69575790-69575812 TTTTATATTTACAAAGGAGAAGG + Intronic
1160420343 18:78739656-78739678 TGTTTTCTAGACAAAGAAGAGGG - Intergenic
1161544046 19:4868991-4869013 TGGTAGCTTTAGAAAGAACATGG + Intergenic
1162763025 19:12899709-12899731 TGTGTTCCTTAAAAAGAAGATGG + Exonic
1162984005 19:14257731-14257753 TGATATCCTTAGAAACAAGAGGG - Intergenic
1164092059 19:21964535-21964557 TTTTTTCATTAGAGAGAAGAAGG - Intronic
1165263743 19:34642758-34642780 TGTCATCTTTAGAGAGATGTTGG - Intronic
1165995130 19:39838698-39838720 TGGTTTCTTTAGAAAGAACCAGG - Intronic
1166252986 19:41584333-41584355 TGTCATCTGCTGAAAGAAGAAGG - Exonic
1166505345 19:43368043-43368065 TGTTATAATAAGAAAGAAAAAGG - Intergenic
1168325449 19:55536562-55536584 TGTTTGCTTTGGAAACAAGATGG - Intronic
925358732 2:3262461-3262483 TGTCACCTCTAGAATGAAGAGGG - Intronic
926132308 2:10311438-10311460 GGATGTCTTCAGAAAGAAGAGGG - Intronic
926467537 2:13209493-13209515 TGTTTTCTTTAAAAAGGAGATGG + Intergenic
928222532 2:29416422-29416444 TGATATTTCTAGAAACAAGAAGG - Intronic
928559970 2:32471927-32471949 TATTATGTTTAGGAAGATGATGG + Intronic
928579155 2:32688445-32688467 TGTTGTCTTCAAAAAGCAGAAGG - Intronic
928581850 2:32716170-32716192 TGTTATGTTTAGAGGGAAAAAGG - Intronic
929692483 2:44086423-44086445 CATTATTTTTAGAATGAAGAAGG + Intergenic
929759759 2:44797382-44797404 TGTTATCTATAGAGAGAGCAAGG - Intergenic
930655863 2:54006749-54006771 TGTTATCTGTAGAAACAATTGGG + Intronic
930696558 2:54417271-54417293 AGACTTCTTTAGAAAGAAGATGG + Intergenic
931036373 2:58248391-58248413 TGTTACCTTTAGAGAGAATGAGG - Intergenic
931962078 2:67493293-67493315 TTTTTTCTTTAGAAAGAAAAAGG + Intergenic
932810551 2:74822238-74822260 TTTTTTTTTTAGAGAGAAGAAGG - Intergenic
933217506 2:79647131-79647153 TTTTATCCTCAGAAAGATGAAGG + Intronic
934167324 2:89306046-89306068 TGTTATAGTTAGAAAAAAAAAGG + Intergenic
934199951 2:89876398-89876420 TGTTATAGTTAGAAAAAAAAAGG - Intergenic
935142646 2:100367342-100367364 TGTTAGCTTTAAAACAAAGATGG + Intergenic
935352486 2:102164757-102164779 ATTTATCTTTAAAAGGAAGAAGG - Exonic
935401926 2:102669054-102669076 TGATTTCTTTGGAAAGATGATGG + Intronic
935637554 2:105261409-105261431 TGTTCTCTAGAGAAAGAGGAAGG + Intergenic
935639687 2:105279097-105279119 TCTTATCTTTAAAAATGAGAGGG - Intronic
935657924 2:105440886-105440908 TGGTGTCTGTAGACAGAAGAGGG - Intergenic
936806772 2:116342778-116342800 AGTTATCTTTAAATAGAAAAGGG + Intergenic
936964244 2:118111759-118111781 TTTTATCTTGAGAAACTAGATGG + Intergenic
937401802 2:121590541-121590563 TTATATCTGTAGAAAAAAGATGG - Intronic
937590692 2:123610008-123610030 TTTTATTTTTAAAAGGAAGAAGG - Intergenic
937605195 2:123792080-123792102 TCTTATCTGTAGAATGCAGATGG - Intergenic
937628028 2:124065899-124065921 TTTTAGCTTTATAAAGCAGATGG - Intronic
937651923 2:124328794-124328816 TAAAATCTTTAGAAAGAAGATGG + Intronic
937885058 2:126893978-126894000 TGGTATGTTTCCAAAGAAGATGG - Intergenic
938150454 2:128878136-128878158 TGTTATTTTTAAAACAAAGAAGG + Intergenic
938660808 2:133485161-133485183 TATTATATTTATAAAGAAAATGG + Intronic
939895285 2:147784232-147784254 TGTTAGTGTTAGAACGAAGATGG + Intergenic
940215746 2:151301691-151301713 AATTATCTTTAGAAATAAGCCGG + Intergenic
941012593 2:160318116-160318138 TGATAGCTTTAGAAAAATGATGG - Intronic
941194338 2:162428895-162428917 TGTTTTCTTTAGACAGCATATGG + Intronic
941428647 2:165384091-165384113 GGGTAGCTTTAGAAAGAAAAAGG + Intronic
941884604 2:170515133-170515155 TGTCACCTATAGAAAAAAGAAGG - Intronic
942877118 2:180814315-180814337 TATTATCTTTAAAAAGAAATAGG + Intergenic
943228921 2:185219642-185219664 TTTTCACTTTAGAAAGAAGTTGG + Intergenic
943632338 2:190267980-190268002 TGTTCTCTCTCCAAAGAAGATGG - Intronic
944436215 2:199692936-199692958 TGTTTTCCTTACAAACAAGATGG + Intergenic
945213265 2:207406091-207406113 TGGCATCTTTAAAATGAAGAAGG - Intergenic
945854342 2:215050335-215050357 TCTTATATATAGAAAGAAAAAGG + Intronic
947113530 2:226745386-226745408 GGTTATTTTCAGAATGAAGATGG + Intronic
947300378 2:228682433-228682455 TCTTATCTTTAGAAAATAGGGGG + Intergenic
949065488 2:241987823-241987845 TGTTCTCTATGGAATGAAGACGG + Intergenic
1169626838 20:7580578-7580600 TGGTATCTTTTGGAAGGAGAAGG + Intergenic
1170512881 20:17097163-17097185 TGTCTTCTGTAGATAGAAGAAGG - Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1172431530 20:34896741-34896763 TGTTGTCTTTAGAAATAAACAGG + Intronic
1174892408 20:54410372-54410394 TGCTATTTTAAGAAAGGAGAAGG + Intergenic
1174959281 20:55136750-55136772 TGTTAGCTTTAAAATGGAGATGG + Intergenic
1177208539 21:18040300-18040322 TATTATCTTTACAAAAGAGAAGG + Intronic
1177350274 21:19930371-19930393 TTTTTTTTTTAGAAAAAAGAAGG + Intergenic
1177444497 21:21175050-21175072 TTTTTTCTTTAAAAAGAAAAAGG + Intronic
1177852545 21:26365896-26365918 TGTTATCATTGCTAAGAAGAGGG - Intergenic
1178729657 21:35089094-35089116 TGTTATCTTTGGGGAGTAGAGGG + Intronic
1180571476 22:16725685-16725707 TGTCATCTATAGAAAGATTATGG - Intergenic
1180820567 22:18824369-18824391 CGTTATTTTTAGGAGGAAGATGG + Intergenic
1181206791 22:21258841-21258863 CGTTATTTTTAGGAGGAAGATGG + Intergenic
1181940731 22:26474124-26474146 AGCTATCTTGAGAAAGAATAAGG + Intronic
1182039284 22:27223957-27223979 TGTCATGTTTGGAAACAAGAAGG + Intergenic
1182700769 22:32236014-32236036 TGCCATCTTTAGGATGAAGAGGG - Intronic
1182945997 22:34322529-34322551 TTTTATTTTTAGAAAAAACAGGG - Intergenic
1184577443 22:45382144-45382166 TGTGATCTTCAGAAAGAATTTGG + Intronic
1184695828 22:46138603-46138625 TGTTTTCCATAGGAAGAAGAAGG - Intergenic
1203220133 22_KI270731v1_random:36582-36604 CGTTATTTTTAGGAGGAAGATGG - Intergenic
1203270693 22_KI270734v1_random:50244-50266 CGTTATTTTTAGGAGGAAGATGG + Intergenic
949191112 3:1250361-1250383 TGTTAACTATGGAAAGAAGGTGG - Intronic
949552986 3:5127642-5127664 TAGTATCTTTAAAAAGCAGAGGG + Intronic
949917642 3:8976971-8976993 AGTTCCCTTTAGAAAGCAGAGGG + Intergenic
950824082 3:15797549-15797571 TGTTTTCTTTAAAAAAAAAAAGG + Intronic
950947350 3:16962799-16962821 AATTATCTTTAGGAATAAGAAGG - Intronic
951227685 3:20140340-20140362 TGTCATCATTAAAAAGCAGAAGG + Exonic
952001379 3:28789295-28789317 TGCTATTTTTTGAAAGCAGAGGG + Intergenic
953078793 3:39596299-39596321 TGCTCTCTTTTGAAAGATGATGG + Intergenic
954336110 3:49918712-49918734 GCTCATCTTTAGTAAGAAGAGGG - Intronic
954533869 3:51343504-51343526 AGTTACCTTTAGAATGAACAAGG + Intronic
955762050 3:62296734-62296756 ACTTATCTCTAGAAAGAAGAAGG + Exonic
955799396 3:62670309-62670331 GGTTATTTGTAGAAAGAACATGG + Intronic
956010960 3:64831175-64831197 TGTCATCCTGAGAAAGAAAAGGG - Intergenic
956043576 3:65172046-65172068 TGTTATCTCTTTAGAGAAGATGG - Intergenic
956700250 3:71952465-71952487 TGGTATCTTTGGAAAGAAGAAGG + Intergenic
956730234 3:72189768-72189790 AGGTATGTTAAGAAAGAAGATGG - Intergenic
957106718 3:75898782-75898804 TGTCATCTATAGAAAGATTATGG + Intergenic
957563965 3:81861380-81861402 TGTTTTGTTTAAAAATAAGATGG + Intergenic
957571102 3:81948366-81948388 TGTCATCTCTGGTAAGAAGAAGG - Intergenic
958082709 3:88767574-88767596 AGTTTCCTTTAGAAAGATGATGG + Intergenic
959223366 3:103550923-103550945 TTTTAACTTTATAAAGAAAATGG + Intergenic
959912872 3:111783887-111783909 TGTTATCTTTAAGAACCAGATGG + Intronic
961105392 3:124236619-124236641 TCTTTTCTTTAGAATAAAGAGGG + Intronic
961135655 3:124508070-124508092 TTTTATCTATAGAAATAAGATGG - Intronic
961970424 3:130958646-130958668 TTTTATCTTTGAAAAGAATAGGG - Intronic
962502688 3:136011026-136011048 TGGTATATTTAGAAAGAGGAGGG - Intronic
962759598 3:138497671-138497693 TGGTATCTTAAGAAAAAAAAAGG + Intronic
963274765 3:143319045-143319067 TGTTATCTTTACATAGTAGTTGG - Intronic
963396679 3:144743346-144743368 AGTTTTCTCTAAAAAGAAGAAGG + Intergenic
963428533 3:145164241-145164263 TGTTATCTTTAAAAAGCTGGAGG - Intergenic
963620901 3:147604855-147604877 TGTTAGCATAAGAAAGAATATGG - Intergenic
963650217 3:147969738-147969760 TGCTTCCTTTTGAAAGAAGAGGG + Intergenic
964743896 3:159993873-159993895 GGTTATCTTTAGCATGAAAAAGG - Intronic
964780887 3:160336521-160336543 TGTTATCTATAGAGAGAGGGAGG - Intronic
965042205 3:163523404-163523426 TGTTATATTCAGAAAGAGCAGGG + Intergenic
965096565 3:164236206-164236228 TGTTATCTGGAGAAAGTAAATGG + Intergenic
965199608 3:165640417-165640439 TCTTATTATTTGAAAGAAGATGG - Intergenic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
966075673 3:175934489-175934511 TATTATATTTAAAAAGGAGAAGG + Intergenic
966623874 3:181995637-181995659 TGTGATCTTTTGAAAGTTGATGG + Intergenic
966649496 3:182283454-182283476 TTTTATTTGTAGAATGAAGAAGG + Intergenic
967222850 3:187262777-187262799 CCTTATCTTTAGAAAGAAAAAGG + Intronic
967755924 3:193168391-193168413 TGTTCTTTTTACAAAGAAGGTGG + Intergenic
968312251 3:197693818-197693840 TGTTATGTTTAAAAACAAAAAGG + Intronic
1202746541 3_GL000221v1_random:107342-107364 TGTTATCCTGAGAAAGCTGATGG - Intergenic
968433608 4:574142-574164 AGTTAGCTTTAGAAAGAGGCTGG + Intergenic
968871529 4:3245140-3245162 TGGTAATTTCAGAAAGAAGAGGG + Intronic
969968201 4:11018523-11018545 TGTGCTCTTTAGAGAGAGGATGG + Intergenic
970206470 4:13660433-13660455 TATTATTTTTTGAAAGAATAGGG - Intergenic
970911854 4:21285920-21285942 TGCTATCTTTAGAACAAAGTTGG - Intronic
970930715 4:21508507-21508529 AGTTATATTTACAAAGAACATGG - Intronic
971393380 4:26206297-26206319 TGATAACTTTAGCAAGAAGAGGG + Intronic
971529544 4:27668578-27668600 TGTTGTCTTCAGAAAAAATATGG + Intergenic
971801335 4:31296060-31296082 TGATTTCTATAGAAAGAAGATGG + Intergenic
972031218 4:34460848-34460870 TCTTATCTTTTGAAACAATAGGG - Intergenic
972387270 4:38579475-38579497 GGTTCTCTTAGGAAAGAAGAAGG - Intergenic
973022470 4:45220550-45220572 TCTTGACTTTGGAAAGAAGATGG - Intergenic
973177059 4:47220152-47220174 TATTATCTAAAGAAAAAAGATGG - Intronic
973980157 4:56301861-56301883 TTTTATCTTTAGAAAAAAAATGG - Intronic
974689571 4:65278990-65279012 TTCTAGCTTTAGAATGAAGATGG + Intergenic
974827153 4:67145953-67145975 TCTCTACTTTAGAAAGAAGAAGG - Intergenic
974982274 4:68973312-68973334 TGTTTTCATTAAAAAGAAGTAGG + Intergenic
975515158 4:75239357-75239379 TGGTCTCTGTAGAAAGAGGAGGG - Intergenic
975967536 4:79992772-79992794 TGTTAGCTTTTAAATGAAGATGG - Intronic
976822839 4:89226378-89226400 TTTTATCTTTAGAGATGAGATGG - Intergenic
976998893 4:91470354-91470376 TAGTATATTTAGGAAGAAGAAGG - Intronic
977149271 4:93489125-93489147 TGTTATTTTTAAAAAGATAAAGG + Intronic
977876991 4:102161994-102162016 TTTTAACCTTAGAAAGAAGATGG - Intergenic
978653388 4:111036338-111036360 TGGTACATTTAGAAAAAAGAAGG + Intergenic
979172823 4:117623372-117623394 TGTTATCTATAGAGAGATTAAGG - Intergenic
979200072 4:117966977-117966999 TGTTCTTATAAGAAAGAAGAGGG + Intergenic
979631300 4:122905971-122905993 TGTTTTCTGTAGCCAGAAGAAGG + Intronic
980277526 4:130673916-130673938 TGTTATCTGTAAAGAGAAGTTGG - Intergenic
981705827 4:147658272-147658294 TGTTTTGTTTAGAAAATAGAGGG + Intronic
981842070 4:149124172-149124194 TGATTTGTTTAGAAAGAGGAAGG + Intergenic
982469238 4:155767155-155767177 GGTTGTCTTTGGAAAGAAGAAGG - Intronic
982998112 4:162377381-162377403 TCTTATATTTTGAAAGAAGAAGG - Intergenic
983476989 4:168225383-168225405 TTTTTTCTTTAGAAAGGAAAAGG + Intronic
984008208 4:174339009-174339031 TGTTATAGGTAGAAATAAGAGGG - Intergenic
984143322 4:176030994-176031016 TGATTTCTTTAAAAAGAATAGGG - Intergenic
984492130 4:180447772-180447794 TATGATCTATAGAAAGAAGTTGG + Intergenic
984749692 4:183260157-183260179 TTTTATTTTTAGAGAAAAGAAGG - Intronic
985126610 4:186701152-186701174 TGTTGTTTTTAGTAAGAAAATGG + Intronic
986835759 5:11635265-11635287 TGTTATCTTTAGAAAGAAGAAGG + Intronic
988140685 5:27235315-27235337 TGTTATTTTCAGAAAAGAGAAGG - Intergenic
988556772 5:32243594-32243616 TGTTATCTGAAAAAAGAAAAAGG + Exonic
989755225 5:44944308-44944330 TGTTAACTCTAGAAACTAGAGGG + Intergenic
989811181 5:45677540-45677562 TGTTATATTTAAAAAGAAGGAGG + Intronic
991025095 5:62020499-62020521 TGGTTTCTTTACAAAGGAGAAGG + Intergenic
993150635 5:84157175-84157197 TTTTCTCTTTAAAAAGAAGTGGG + Intronic
993229990 5:85222746-85222768 TGTAATATTAAGAAAGAAGTGGG - Intergenic
994177045 5:96722252-96722274 TGTTATTTTCAGAAAAAACATGG - Intronic
994349435 5:98727491-98727513 TGGTATCTTTGGAAAGAAAGAGG - Intergenic
995078241 5:108013604-108013626 TCTTGTGTTGAGAAAGAAGACGG - Intronic
995170357 5:109103940-109103962 TGATATCTTCAGAAAGTAAAAGG + Intronic
995314049 5:110747267-110747289 TGTAACCTTTAAAAATAAGAGGG + Intronic
995740358 5:115349618-115349640 ATTTTTCATTAGAAAGAAGATGG - Intergenic
996539446 5:124613702-124613724 TGTTATTTTGAGATAGAAAAAGG + Intergenic
996932187 5:128903369-128903391 TTTTATTTTTAGAAAAAAGATGG + Intronic
997653900 5:135541586-135541608 TGTGATCTTTATAGAAAAGAAGG + Intergenic
998199562 5:140108414-140108436 TGTTCTCTTTTGAAAGTAGGAGG - Intronic
998508362 5:142690441-142690463 GGTTATCTTTGGAGAAAAGAGGG - Intronic
998960203 5:147478441-147478463 TGGTACCTTTGGAAAGAAGAAGG + Intronic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
1001112189 5:168905864-168905886 TTTTGACTTTGGAAAGAAGAAGG + Intronic
1001146582 5:169190019-169190041 TGTTATCAGAAGACAGAAGAGGG - Intronic
1002812774 6:649199-649221 TTTTATCTTTGGAAAGCATAGGG + Intronic
1002907731 6:1464494-1464516 TGTCATCATCAAAAAGAAGAGGG + Intergenic
1003649016 6:7941162-7941184 TGTACTATTTAGAAAGAAAAAGG + Intronic
1003965141 6:11245807-11245829 TGTTATGGTTAGAAAGATTATGG + Intronic
1004037837 6:11941258-11941280 TGGTATCCTTGTAAAGAAGAAGG - Intergenic
1004921737 6:20382187-20382209 TGTTAACTTTAAAACAAAGATGG - Intergenic
1005816886 6:29560354-29560376 TGTAATCTTTAGAAAAGAGTAGG + Intronic
1006954227 6:37852992-37853014 TGTTGGTCTTAGAAAGAAGAAGG + Intronic
1007020598 6:38516944-38516966 TGTTCTCTTTAAAATGAAGTTGG + Intronic
1007148350 6:39660790-39660812 TGATTTATTTAGAAAGAAAATGG - Intronic
1007951753 6:45878728-45878750 TGATTTCTTTAGAAAAGAGAGGG + Intergenic
1008495550 6:52129796-52129818 TGTTTTCTTCAGAAATAAAATGG + Intergenic
1008827089 6:55709341-55709363 TCTTCTCTCTAAAAAGAAGATGG - Intergenic
1010143729 6:72641695-72641717 TATTATCATTAGAAAGGTGATGG + Intronic
1010185583 6:73139873-73139895 TATTAACTTCAGAAGGAAGAAGG - Intronic
1010360845 6:74991652-74991674 TATTGTCTTTAGAAAGAAATTGG + Intergenic
1010665122 6:78619927-78619949 TTTTCTTTTAAGAAAGAAGAAGG - Intergenic
1011339588 6:86299176-86299198 TCTTTTCTTTATACAGAAGAAGG - Intergenic
1011782958 6:90810848-90810870 TTTTATCTTTTGTAAGAAAATGG + Intergenic
1011839726 6:91482041-91482063 TTTTATTTTTAGAAACAAAAAGG + Intergenic
1012394113 6:98776101-98776123 TGTGATATCAAGAAAGAAGAGGG - Intergenic
1013251716 6:108340894-108340916 TGTTCTCTTTATGAAGAAGTAGG + Intronic
1013888956 6:115002604-115002626 TGCTGTCATTAGAAAGAAAATGG - Intergenic
1014033333 6:116735726-116735748 TGTTAGTTTTAGAAAGTAAATGG - Intronic
1014492045 6:122074563-122074585 TGTTACCTTTGCTAAGAAGAGGG + Intergenic
1014650700 6:124033357-124033379 TGTTATAATTAGTAAGAAGAGGG - Intronic
1014906246 6:127032162-127032184 TCTTATCTTAAGAAAGTAGTTGG - Intergenic
1015004291 6:128259539-128259561 AGTCATCTCTAGAAAGCAGAAGG + Intronic
1015865649 6:137723843-137723865 TGTTTTCTTTTAAGAGAAGAGGG + Intergenic
1015944630 6:138487295-138487317 TGTTATCTTTAAAACGAACTTGG - Intronic
1016338813 6:143038742-143038764 TGTTATGGTAAGAAGGAAGAAGG - Intergenic
1016655039 6:146508950-146508972 TGATATCTTTAGCACAAAGAGGG + Intergenic
1017026048 6:150181655-150181677 TACTATGTTTAGAAACAAGAAGG - Intronic
1017230875 6:152072365-152072387 TGATATTTTAAGAAAGAGGAGGG + Intronic
1017510020 6:155105753-155105775 TGTTATTTTTAAAATGATGAAGG + Intronic
1017565823 6:155685543-155685565 TTTGATATTTAGAAAGAAAATGG - Intergenic
1017610037 6:156175832-156175854 TGTTAATGTTAGAAAGAAAAAGG - Intergenic
1017712166 6:157180629-157180651 TGTTATTTTTAAAAATAAAAGGG - Intronic
1018272127 6:162091730-162091752 TTTTATCAGTAGAAAGAAAAAGG + Intronic
1019924516 7:4183261-4183283 TGTTATCTTTAGAAGCAACTGGG + Intronic
1019935830 7:4257015-4257037 TTTTCTGTTTAGAAACAAGAGGG + Intronic
1020502972 7:8946270-8946292 TCTAATCTTGAGAAATAAGATGG + Intergenic
1020766718 7:12331192-12331214 TCTTATCTGTAGTAGGAAGAAGG + Exonic
1020818091 7:12931144-12931166 TTTAATCTTTAGAATGAAGGTGG + Intergenic
1020877838 7:13720655-13720677 TGTTATCGTTATAAACCAGAGGG - Intergenic
1021012401 7:15486744-15486766 TTTTATCTTTAGAAATATCACGG + Intronic
1021026537 7:15674600-15674622 TGTTGTCTTTAGAAAACAAAAGG + Intronic
1021141259 7:17028418-17028440 TGGCACCTTTAGAAGGAAGAAGG + Intergenic
1021160442 7:17265911-17265933 AGTAATCTTGAGTAAGAAGAAGG - Intergenic
1021291410 7:18849877-18849899 TGTTATCTTTGGAAACAAAATGG - Intronic
1022203643 7:28142139-28142161 TGTCCTGTTTACAAAGAAGAGGG - Intronic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1022626302 7:32040275-32040297 TATTCTCTTTTTAAAGAAGAAGG + Intronic
1022633594 7:32109786-32109808 TCTTTTCTTTAGAGGGAAGAGGG + Intronic
1022832250 7:34079464-34079486 TGCTATTTTTAGACAGAGGATGG - Intronic
1023085072 7:36562300-36562322 TGTTATCATTAGAGAAAATACGG + Intronic
1024188675 7:46982455-46982477 TGTTACCTTTTGAAAAAAAAAGG + Intergenic
1024995352 7:55269919-55269941 TGCTATCTCTAGAAATAATATGG + Intergenic
1026244459 7:68606439-68606461 TGTCATCTGAAGAAATAAGATGG - Intergenic
1028002307 7:85514723-85514745 AGTTAGCTTTAGAAGCAAGATGG - Intergenic
1028534510 7:91877472-91877494 TGATATCTTTAGTCAGAAGAGGG - Intronic
1028682524 7:93553046-93553068 TGATATATTTTGAAAGAAGAAGG - Intronic
1028853289 7:95561207-95561229 GTTTATCTTGAAAAAGAAGACGG - Intergenic
1029040203 7:97565283-97565305 TGTGATGTTTAAGAAGAAGATGG + Intergenic
1030076882 7:105744638-105744660 TGTAATCTTTAAAAACATGAAGG + Intronic
1030150291 7:106397784-106397806 TGTGATCTAGAGAGAGAAGAGGG + Intergenic
1031228752 7:119076576-119076598 TATTTTCTATAGAAAGTAGAGGG + Intergenic
1031345904 7:120666379-120666401 TATTATCTTTAGAAAGAAACTGG - Intronic
1031464170 7:122087886-122087908 TGAAATCCTTACAAAGAAGATGG + Intronic
1031575793 7:123414620-123414642 TGTTATGTTTTCAATGAAGATGG - Intergenic
1032638790 7:133741417-133741439 TGTTAACTAAAGAAAGAAAATGG - Intronic
1033257335 7:139813537-139813559 TGTTATCATTCAAAAGAAGCAGG - Intronic
1033474668 7:141680305-141680327 TGCTATCTTTTGCAAGAAAAGGG + Intronic
1033670999 7:143493003-143493025 TCTTTTCTTGATAAAGAAGATGG - Intergenic
1034080411 7:148272102-148272124 TGTGATCTTTATAAAGGGGATGG + Intronic
1034298004 7:149991194-149991216 TGTTCTCTTGAGAATGAATAGGG - Intergenic
1035950161 8:4011016-4011038 TGGCAGCTTTAGAAGGAAGAAGG - Intronic
1036532329 8:9603493-9603515 TGTTCTCTTTAGCAATAAAATGG - Intronic
1036599516 8:10247523-10247545 TCTTATGTTTAGAAGGAAAAAGG + Intronic
1036746086 8:11410960-11410982 TATTTTCTTTATAAAGAAGTGGG + Intronic
1037372681 8:18196766-18196788 TATTATTTTAAGAAAGAGGAAGG + Intronic
1037593923 8:20337931-20337953 TTTTATCTTTTTAAAGAAAAAGG - Intergenic
1038028549 8:23615620-23615642 GGGGATCTATAGAAAGAAGACGG + Intergenic
1038688647 8:29741538-29741560 TGTTATCTTTAAAAAAACCATGG - Intergenic
1039095707 8:33882058-33882080 TGTTGTCTATAGATAGATGATGG + Intergenic
1039143937 8:34423963-34423985 TGTTATCATTAGAAAGATTGAGG + Intergenic
1039268993 8:35860114-35860136 TGTTATATTTAGAAACATGGAGG - Intergenic
1041025324 8:53679618-53679640 TGATATCTTCAGAAACTAGAGGG + Intergenic
1042086284 8:65112723-65112745 TGTTATTATTATAAAGAGGATGG - Intergenic
1043657813 8:82693451-82693473 TGCTATATTTGGAAAGAACAAGG + Intergenic
1043942034 8:86206735-86206757 TGTTATCTTTTTAAAAAATAAGG - Intergenic
1045527367 8:102952659-102952681 AGTTATCTATAAAAAGCAGAAGG - Intronic
1045617727 8:103938063-103938085 TATTTTCTTTAAAAAGAAAATGG + Intronic
1045685497 8:104707173-104707195 TTTTATCTTAAGGAAGAAGAGGG + Intronic
1046255971 8:111696475-111696497 TATTTTCTTTAGAAATAATAAGG - Intergenic
1046823051 8:118656052-118656074 TCTTACATTTAGAAAAAAGAAGG + Intergenic
1046925160 8:119778915-119778937 AGTTATTTTGAGTAAGAAGAGGG - Intronic
1047897385 8:129381906-129381928 TCTTCTCTTTTGAAAAAAGATGG - Intergenic
1047935852 8:129777458-129777480 TGTTATATTACGAAAGAAGAAGG - Exonic
1048561515 8:135543656-135543678 TGTTATCCTTGGAAAAATGATGG + Intronic
1048654882 8:136524591-136524613 TATTATTTTTAGAAGAAAGAGGG + Intergenic
1048815927 8:138333545-138333567 TATTATCTTTAGAAAACAGTGGG - Intronic
1050103528 9:2142848-2142870 TGTCATCCTGAGAAAGCAGAGGG + Intronic
1050288816 9:4131921-4131943 TATTTTCTTTAGAAAGAGAATGG - Intronic
1051579295 9:18653382-18653404 TGTTGTCTAAAGAACGAAGAAGG - Intronic
1051650198 9:19315421-19315443 TGCTAACTTTTGTAAGAAGAGGG + Intronic
1053368264 9:37539254-37539276 TTTTATCTTTAGAGAGAAAATGG - Intronic
1054744571 9:68841795-68841817 TGATTAATTTAGAAAGAAGAAGG + Intronic
1054885140 9:70188775-70188797 TTTTTTTTTTAGAAAGAAGTGGG + Intronic
1055003233 9:71477661-71477683 TGTTTTCTTTAGAAGGAATTTGG - Intergenic
1055184602 9:73435461-73435483 TTTTATTTTTAGAAAAAGGAAGG - Intergenic
1055635922 9:78279479-78279501 TGTTATTATTTTAAAGAAGAAGG + Intronic
1055915678 9:81397725-81397747 TGTTATCTTCAGGGAGGAGAGGG - Intergenic
1055939118 9:81632522-81632544 TGCTATGTTCAGAAAGAAGGAGG + Intronic
1056245724 9:84693059-84693081 TGTTGTCTTAAGAAAACAGAAGG - Intronic
1056574510 9:87844568-87844590 GTTTGTCTTTAGAATGAAGAAGG + Intergenic
1058991966 9:110262920-110262942 TGTCCTCTTTACAAAGGAGATGG + Intergenic
1059832366 9:118111809-118111831 TGTTAACTCTGGAAAGAAAAAGG + Intergenic
1062162864 9:135089293-135089315 TGCTATTTTTAGCATGAAGATGG - Intronic
1203691374 Un_GL000214v1:46045-46067 TGTTATCTTTAAAAAAAAAATGG - Intergenic
1203644921 Un_KI270751v1:58146-58168 TGTTATCTTTAAAAAAAAAATGG + Intergenic
1185855395 X:3530119-3530141 TGTTATTCTTTGAAAGTAGATGG + Intergenic
1186264219 X:7814168-7814190 TGTTATCTATAGAAACAATTAGG + Intergenic
1186320767 X:8422064-8422086 AGTTATCTCTGGAAAGAAAATGG - Intergenic
1186366966 X:8905758-8905780 TGTAATCTTTATAAAGCATATGG - Intergenic
1189961531 X:46329159-46329181 TGTCATTTTTAAAAAGTAGAGGG - Intergenic
1190338336 X:49276847-49276869 TGTTCTTTTCAGAAAGCAGATGG + Intronic
1190873167 X:54441681-54441703 TGTTATATTTGGAAAGTAGCAGG + Intronic
1193539680 X:82755977-82755999 TGTTTTGTTAAGAAAGAGGAAGG + Intergenic
1193847012 X:86484587-86484609 TGCTGTCTTTAGAAAGAAGTGGG + Intronic
1194227196 X:91275489-91275511 TGTTATCTTCAGTTAGAAGAAGG - Intergenic
1194581232 X:95674299-95674321 GCTTCTCTCTAGAAAGAAGAAGG - Intergenic
1195708235 X:107753530-107753552 GGTTATAGTTAGGAAGAAGAAGG + Intronic
1196047619 X:111272843-111272865 TGATATCTTCATGAAGAAGATGG - Intergenic
1196839359 X:119844490-119844512 CATTATATTTATAAAGAAGAAGG - Intronic
1197501664 X:127250257-127250279 TGTTTTGTTTAGAGAGGAGAGGG + Intergenic
1198940016 X:141943969-141943991 TGATGTCTTTAAAAGGAAGATGG - Intergenic
1199535667 X:148900113-148900135 TGTTATCATTATAAAGAAAATGG + Intronic
1199689429 X:150297163-150297185 TGTTCTCTATAGAAATAAGCAGG - Intergenic
1199820934 X:151445141-151445163 TTCTATCTTTTGAAAGAAAATGG + Intergenic
1201416667 Y:13754103-13754125 TGTAATAATTAGAAGGAAGATGG + Intergenic
1201677831 Y:16607499-16607521 TGTTGTCTTTAGAAATAAGGTGG + Intergenic
1201947226 Y:19524361-19524383 TCTTATCTTCAGAAAGACAAAGG - Intergenic